<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving DTD v1.0 20120330//EN" "JATS-journalarchiving.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:ali="http://www.niso.org/schemas/ali/1.0">
  <front>
    <article-meta>
      <title-group>
        <article-title>Involvement of p.R72Pand PIN3 Ins16bp (<italic id="italic-1">TP53</italic>) Polymorphisms and the I157T (<italic id="italic-2">CHEK2</italic>) Mutation in Breast Cancer Occurrence in Burkina Faso</article-title>
      </title-group>
      <abstract>
        <p id="_paragraph-1"><bold id="bold-1">Introduction: </bold>The <italic id="italic-118461cdffffba48960bb39dd4055be8">TP53 </italic>and <italic id="italic-310fc303a36a5b96ac1ae8bc7183f39e">CHEK2 </italic>genes have been described as breast cancer susceptibility genes and some of their polymorphisms have been associated with an increased risk of breast cancer in certain populations. <bold id="bold-2">Aim: </bold>The objective of this study was to investigate the p.R72P and PIN3 Ins16bp (<italic id="italic-3">TP53</italic>) polymorphisms and the I157T (<italic id="italic-4">CHEK2</italic>) mutation developping of breast cancer. <bold id="bold-3">Methods: </bold>This case-control study had enrolled 144 participants including 65 cases (breast cancer patients) and 79 controls (women without breast abnormalities) in the city of Ouagadougou in Burkina Faso. The DNA was extracted using the method of “salting out” and the genotyping of polymorphisms was performed by ASO-PCR (Allele Specific Oligonucleotides - Polymerase Chain Reaction), conventional PCR and PCR-RFLP (Polymerase Chain Reaction - Restriction Fragment Length Polymorphism) techniques. <bold id="bold-4">Results: </bold>The heterozygous genotype (RP) of the p.R72P polymorphism of <italic id="italic-5">TP53 </italic>gene was in the majority in cases (73.85%) and controls (73.42%). Regarding to the PIN3 Ins16bp polymorphism of <italic id="italic-6">TP53 </italic>gene, the homozygous wild type (A1A1) was the most represented in both cases (53.85%) and controls (60.76%). Concerning the I157T mutation of <italic id="italic-7">CHEK2 </italic>gene, only one (01) patient was homozygous mutant (TT) and no controls had the mutation. This study found no association between these polymorphisms and the risk of breast cancer occurrence (p.R72P (OR=0.96; 95%IC (0.59-1.56); p=0.471), PIN3 Ins16bp (OR= 1.1; 95%IC (0.61-1.98); p=0.420)). <bold id="bold-5">Conclusion: </bold>This study showed that the P allele of the p.R72P polymorphism and the wild-type allele (A1) of the PIN3 Ins16bp polymorphism were in the majority. The I157T mutation was very rare. These polymorphisms were not associated with the risk of developing breast cancer in this study.</p>
      </abstract>
    </article-meta>
  </front>
  <body id="body">
    <sec id="heading-453d0df6a94290c56881a38b97b17cdd">
      <title>Introduction</title>
      <p id="heading-afebb85eab472fce4da3569f9af825d3">Breast cancer is a major public health problem. In 2020, 2.3 million new cases were diagnosed, representing 24.5% of all new cases of cancer in women worldwide [1]. In Burkina Faso, during 31 years, 14,587 cases of cancer have been diagnosed histologically in the anatomical pathology laboratories of Burkina Faso [2]. Among these cancers, breast cancer is the leading cancer in terms of incidence and prevalence It is also the most frequent cause of cancer mortality in women in Burkina Faso [2-4]. </p>
      <p id="paragraph-3fe4683df151a9090f6f9c2452ab83c5">The exact causes of breast cancer are not clearly identified, but several studies have implicated a wide variety of factors in its genesis. Age, gender, heredity, reproductive factors, diet, the presence of other cancers, anthropometric characteristics, psychological and environmental factors as possible risk factors [5,6]. It’s reported that polymorphisms or mutations in some genes such as <italic id="italic-033985a4be3b6ec33e26d70683c1768b">BRCA1</italic>, <italic id="italic-713e93da3231496fe039b7176dced528">BRCA2</italic>, <italic id="italic-bb0b5797b352052d5fa4a98bf19b83ee">CHEK2</italic>, <italic id="italic-7262bfbb9202a18896013509ff6bcf6e">PALB2</italic>, <italic id="italic-83c805e5754255c9b73811a86c9691fe">TP53</italic>, <italic id="italic-9fadd7beda2b418d2a9b795d57129e49">ATM</italic>, <italic id="italic-6a87e5bd8a1224a92909b92f6e53d6db">PTEN </italic>are involved in the occurrence of breast cancer [7]. The <italic id="italic-8">TP53 </italic>gene is a tumor suppressor located on chromosome 17p13.1. It is 20kb of long and includes 11 exons and 10 introns [7]. It codes for a transcription factor: the p53 protein. The latter is a nuclear phosphoprotein with molecular weight of 53 kDa which is involved in the control of cell cycle progression, DNA repair, apoptosis and senescence [8-10]. Mutations or loss of function of the <italic id="italic-9">TP53 </italic>gene represent the most common genetic abnormality in sporadic breast cancer. It is altered in more than half of all human tumors, underscoring the importance of its function [11]. Its protein is considered as a “guardian of the genome” and plays many major roles in cell function [12]. </p>
      <p id="paragraph-7d88edf8c5c8a1d6ea7544f439ea9c1e">Several polymorphisms of <italic id="italic-10">TP53 </italic>have been studied. The SNP p.R72P (rs1042522) of the <italic id="italic-11">TP53 </italic>gene is one of the most studied polymorphisms of <italic id="italic-12">TP53 </italic>gene [8,13]. It is located in exon and characterized by the presence of an arginine (R) or a proline (P) in position 72 [7]. This is explained by a substitution of a guanine (G) by a cytosine (C) at codon 72 of the <italic id="italic-13">TP53 </italic>gene [8]. This polymorphism exists in two isoforms (Arg72 and Pro72) which differ in their biochemical and biological properties [8]. Various meta-analysis studies have reported the involvement of p.R72P in the susceptibility to various cancer types, including gastric [14] and breast cancers [15]. However, studies on the association of breast cancer risk with the p.R72P polymorphism have not given consistent results [8]. The PIN3 Ins16bp polymorphism (rs17878362 is a duplication of 16 pairs of bases in intron 3 of <italic id="italic-14">TP53 </italic>gene. It affects mRNA splicing, modifying the coding regions [7]. This polymorphism was associated with reduced p53 mRNA levels and decreased apoptotic indices and DNA repair capacity in lymphoblastoid cell lines [16]. This explains its involvement in various cancers such as colon cancer [16] and breast cancer [17]. </p>
      <p id="paragraph-88e08c3ebfe535682e6918aa066c848c">The <italic id="italic-15">CHEK2 </italic>gene is long of 50 kb and located on chromosome 22q12.1. Consisting of 14 exons, it codes for <italic id="italic-16">CHEK2</italic>, stable protein of 60 Da consisting consisting of 546 aa [18]. Activation of p53 by activated <italic id="italic-17">CHEK2 </italic>results in phosphorylation of p53, which stabilizes the p53 molecule [19,20]. Previous studies have shown that the association of <italic id="italic-a63fc1ca3e05208ffcf4bc3943d41af2">CHEK2 </italic>with breast cancer is of low frequency and moderate penetrance in some countries [21]. The 1100delC and I157T mutations are among the most studied, conferring risks or not in the occurrence of breast cancer depending on the region and population studied. The I157T mutation is associated with an elevated risk of developing thyroid, breast, colon, kidney and prostate cancers [22]. Genetic predisposition to breast cancer in the african population is poorly studied [23].</p>
      <p id="paragraph-2">The objective of this study is to determine the involvement of the p.R72P and PIN3 Ins16bp polymorphisms of the <italic id="italic-30b32ac8ad18857218755e6a324e099e">TP53 </italic>gene and the I157T of the <italic id="italic-b0f2a92f52b9e4f07a484eaad5afe0a4">CHEK2 </italic>gene in the development of breast cancer in a sample from Burkina Faso.</p>
    </sec>
    <sec id="heading-8a2073c008e23dc21aed28dcf7c3de8d">
      <title>Materials and Methods</title>
      <sec id="heading-c841d8e56a1b8efd884ab3e917881336">
        <title>
          <italic id="italic-8d7ff0c3786bbc4aefd81194ee5f75bd">Site, type and period of study<italic id="italic-27896535110072355c544d3838572f49"/></italic>
        </title>
        <p id="heading-428ca84acd54704d5792296a5d3a86c4">This study was a case-control study conducted between October 2019 and October 2021 in the city of Ouagadougou, capital of Burkina Faso (West Africa). The study population consisted of 144 participants, including 65 patients with breast cancer histologically confirmed by a pathologist and 79 healthy controls without breast cancer who came for medical consultations at the University Hospitals: Yalgado Ouédraogo (CHU-YO) and Bogodogo (CHU-B); and at the Medical Centers with Surgical Branch (Paul VI and Schiphra). Biomolecular analyses were performed at the Laboratory of Molecular Biology and Genetics (LABIOGENE), and at the Pietro Annigoni Biomolecular Research Center (CERBA).</p>
        <p id="paragraph-4a10b0813a1d06abccf8ebe95a6c0b0e">We are included in this study the cases related to all female patients with sporadic breast tumor or family history of breast cancer (hereditary) living in Burkina and whose the diagnosis is confirmed histologically by anatomo-pathologist. The cases were recruited during medical consultations (chemotherapy or chemotherapy interval check-up).</p>
        <p id="paragraph-3">The controls included were all female living in Burkina, without any breast anomaly (as confirmed by mammography). Controls were selected from patients admitted to the same hospital for illnesses other than breast cancer.</p>
        <p id="paragraph-4">We are excluded all men, any patient without histological confirmation of breast cancer ; any patient who voluntarily refuses to participate in the study.</p>
        <p id="paragraph-5">Patients were classified as “sporadic breast cancer cases” if no one in their family had or currently has breast cancer. Patients were considered as with “family history of breast cancer” if at least one member of their family (niece, sister, mother, cousin, etc.) had or currently has breast cancer.</p>
        <p id="paragraph-6">We are included all ages were in the study and all patients included in the study freely consented to their participation. We scrupulously respected confidentiality and anonymity. Written informed consents were obtained from each patient and control.</p>
        <p id="paragraph-7">Our study was conducted according the Helsinki Declaration guidelines on ethics in medical research and obtained approval from the Health Research Ethics Committee (CERS) of Burkina Faso (Deliberation No. 2019-5-067 of 15 May 2019).</p>
      </sec>
      <sec id="heading-f7eeaae969c84b8d86028540d66c0c7d">
        <title>
          <italic id="italic-b1561ccf2e1beee5c44fd627ca215a68">Sample collection and DNA extraction<italic id="italic-d1e8cc28045ca3900e72977f5eb503ac"/></italic>
        </title>
        <p id="paragraph-13fb8482ff77d936ebeaf5f6c981914e">The socio-demographic, anthropometric and residence data of the participants were obtained via questionnaires. The questionnaires were administered by trained interviewers or working in the field of breast cancer. According to patient’s residence, we used the classification of INSD [24]: urban if the women lived in town (province capital or urban municipality status) with a population greater than 10,000 inhabitants and rural if the community size was smaller. The age at diagnostic was determined by verification of identification card of each participant. Then, 5mLof venous blood from each consenting woman was collected on EDTA (Ethylene-Diamine-Tetra-Acetic) impregnated tubes, centrifuged at 13000 rpm for 15 min, plasma and pellet were stored at -20°C with individual codes. DNA was obtained from the blood pellets by the “Salting Out” technique as described by Miller et al. [25]. Then, using the Biodrop, the DNA extracts were quantified and the purity verified.</p>
      </sec>
      <sec id="heading-581be2fd0069421eb17413ee9a801723">
        <title>
          <italic id="italic-91877c97101ba995b9bd2946a0594cd7">Molecular characterization of polymorphisms<italic id="italic-9ae92d2985051183905e52de4db1f246"/></italic>
        </title>
        <p id="paragraph-a5c95ef54a599365c0d0035e97f3937f">The genotyping of the p.R72P and PIN3 Ins16bp polymorphisms of the <italic id="italic-ec73c5acfac6943c3a4c4a6252ec6421">TP53 </italic>gene was performed respectively by ASO-PCR and conventional PCR [26,7]. PCR-RFLP was used for the I157T mutation of the <italic id="italic-220bdd1ce875c67495b6d570562e510e">CHEK2 </italic>gene [27].</p>
      </sec>
      <sec id="heading-e560bbe81786e8e14fc9fb8a6a79215b">
        <title>
          <italic id="italic-e7bf84bf06747a74fdc446bc061e603b">PIN3</italic>
          <italic id="italic-478ee9dc19bdc101a9fb22757c2f9797" />
          <italic id="italic-a4883f0a6b02d289fc84cf7c3d30d0d5">Ins16bp</italic>
          <italic id="italic-6e0101e5d01c63cc00f11852d6225ab9" />
          <italic id="italic-0df21b84e529031cde949da992052489">polymorphisms</italic>
          <italic id="italic-57719d5de5657e20be027cb2e919b4d9" />
          <italic id="italic-62d9d464b1ffb404aa9bcfd2ce0fd7cd">of</italic>
          <italic id="italic-c06c30e4099898132ac2ccd6f7e596a7" />
          <italic id="italic-85d0627285804fd7ced2a1f45ac1d1e1">the</italic>
          <italic id="italic-82f2c9b423e91cb420f245b8aea43373" />
          <italic id="italic-91cdaef723883280bf2ed2130a28e053">TP53</italic>
          <italic id="italic-e7fe8a8963450488fa54725335706e84" />
          <italic id="italic-b6d161532205dcc8f4763f5991713cd8">gene</italic>
          <italic id="italic-9c1d5f0100fa1acadca2b78279057944" />
          <italic id="italic-5cf075d87aef357e548bd4fad9ddbae9">and</italic>
          <italic id="italic-ac2f6064baffdc08a4fed78ee7cf437e" />
          <italic id="italic-2054ff9fb33b3359f1f00a16c4516803">I157T</italic>
          <italic id="italic-18" />
          <italic id="italic-19">of the CHEK2 gene<italic id="italic-20"/></italic>
        </title>
        <p id="heading-e5ef8321466f0c8f6d9360a9dc265099">The reaction mix had a volume of 15μl for each polymorphism consisting 3μl of DNA, 2.8μl 5X FIREPol® Master Mix (Solis Biodyne), 8.2μl of sterile water, and 0.5μl of the R and F primers (0.5μM). The sequences of the primer pairs [7] are recorded in Table 1.</p>
        <table-wrap id="table-figure-0fadec68906693b031d602d6f1eeb689">
          <label>Table 1. Primer Sequences and Amplicon Sizesa</label>
          <caption>
            <title></title>
            <p id="paragraph-566625a1f7df14d7bc5d9d0e4f80a3e2" />
          </caption>
          <table id="table-ca38269d28466ae03f3c7743b4e9acf6">
            <tbody>
               <tr>
               <td>Polymorphism</td>
               <td>Primers</td>
               <td>Size</td>
            </tr>
            <tr>
               <td>p.R72P (rs1042522) of TP53</td>
               <td>Arg F: 5’-TCC CCC TTG CCG TCC CAA-3’ </td>
               <td>Allele P: 177 bp </td>
            </tr>
            <tr>
               <td> </td>
               <td>Arg R: 5’-CTG GTG CAG GGG CCA CGC-3’</td>
               <td>Allele R: 141 bp</td>
            </tr>
            <tr>
               <td> </td>
               <td> Pro F: 5’-GCC AGA GGT TGC TCC CCC-3’ </td>
               <td> </td>
            </tr>
            <tr>
               <td> </td>
               <td>Pro R: 5’-CGT GCA AGT CAC AGA CTT-3’</td>
               <td> </td>
            </tr>
            <tr>
               <td>PIN3 Ins16bp (rs17878362) of TP53</td>
               <td>F: 5'-CTGAAAACA ACG TTC TGG TA-3</td>
               <td>Allele A1: 119pb </td>
            </tr>
            <tr>
               <td> </td>
               <td>R: 5'-AAG GGG GAC TGT AGA TGG GTG-3'</td>
               <td>Allele A2: 135pb</td>
            </tr>
            <tr>
               <td>I157T of CHEK2</td>
               <td>F: 5′- GCAAGAAACACTTTCGGATTTTCCGG -3′ </td>
               <td>PCR: 194pb Digestion (PstI): </td>
            </tr>
            <tr>
               <td> </td>
               <td>R: 5′- CCACTGTGATCTTCTATGTCTGCA-3′</td>
               <td>20bp and 170pb</td>
            </tr>
            <tr>
               <td>β-globine</td>
               <td>Forward: 5'-CAACTTCATCCACGTTCACC-3' </td>
               <td>260 bp</td>
            </tr>
            <tr>
               <td> </td>
               <td>Reverse: 5'-GAAGAGCCAAGGACAGGTAC-3'</td>
               <td> </td>
            </tr>
            </tbody>
          </table>
        </table-wrap>
        <p id="paragraph-77594364db1e5b66e8b0945153b9971d">The amplification was performed in a Gene Amp®PCR System 9700 (Applied Biosystems™) thermal cycler following the amplification programs: an initial denaturation at 95°C, 5 minutes, followed by 35 cycles of amplification (denaturation at 95°C for 45 sec, hybridization at 55°C for 30 sec (PIN3 Ins16bp of the <italic id="italic-399f017a13d3bd7689a5712a0d13b646">TP53 </italic>gene), hybridization at 61.5°C for 40 sec (I157T of the <italic id="italic-a93ac557b788f8180a79eef9c102f82a">CHEK2 </italic>gene), and elongation at 72°C for 45 sec) and a final extension at 72°C for 10 minutes. PCR products of the <italic id="italic-b1aede7179a74fde33e60554ede2cf99">CHEK2 </italic>gene were digested with the restriction enzyme <italic id="italic-f5b3b2b1b8c9330188184e35484af423">PstI </italic>[27]. In short, a reaction mix in a volume of 25μl consisting of 1μl of <italic id="italic-2c40ead68d2208877bdf3d6eb72907c9">PstI </italic>enzyme (20U/μl), 5μl of Buffer 3.0 1X, 14μl of H<sub id="subscript-1">2</sub>O, and 5μl of PCR product, was placed in each PCR plate. This mixture was then incubated at 37°C according to the manufacturer’s protocol for three (03) hours.</p>
      </sec>
      <sec id="heading-ee9200843aff4bae390c78a13eca8e2f">
        <title>
          <italic id="italic-c011731e62cb8c16fa7b70ea975b845e">p.R72P polymorphism of the TP53 gene<italic id="italic-e7816a75b1712b31d5414ac0351c4500"/></italic>
        </title>
        <p id="paragraph-b2b09c15c91ec1fd2eaa32bfeab24b24">The reaction mix had a total volume of 15μl for each polumorphism consisting of 3μl of DNA (10ng/μl), 2.8μl 5X FIREPol ®Master Mix (Solis Biodyne), 8.2μl of sterile water; 0.5μl of each primer pair of the R allele or P allele (0.5μM) and 0.5ul of the Reverse (R) and Forward (F) primers; (0.5μM) of the primers for β-globin gene have been used as internal control. The sequences of the primer pairs [28] are recorded in Table 1. The amplification was performed in a Gene Amp®PCR System 9700 (Applied Biosystems™) thermal cycler. The amplification program for the p.R72P polymorphism (R and P allele) was : an initial denaturation at 95°C, 15 minutes, followed by 35 cycles of amplification (denaturation at 95°C for 30 sec, hybridization at 60°C for 30 sec and elongation at 72°C for 30 sec) and a final extension at 72°C for 5 minutes. We have amplified the P allele and the R allele in separate reactions mix. For the internal control β-globin, the program was : an initial denaturation at 95°C, 15 minutes, followed by 10 cycles (β-globine) of amplification (denaturation at 95°C for 30 sec, hybridization at 60°C for 30 sec, and elongation at 72°C for 30 sec and a final extension at 72°C for 5 minutes.</p>
        <p id="paragraph-658735a50d0bced6e52855c3e85c8331">PCR products were migrated on 2% gel for p.R72P and PIN3 Ins16bp of <italic id="italic-3b7399e355ee2123f2de9264ed5f337c">TP53 </italic>gene, 4% for I157T polymorphism of <italic id="italic-ce4603252a32234bc9f5ea6903a3ec46">CHEK2 </italic>gene subjected to 100Volts and 80 mA voltage</p>
        <p id="paragraph-b4e87a8436f6296372f938ba4c667d3d">Finally, DNA visualization was done with the Gene Flash Revelation (Synengege Bio Imaging, USA) instruments.</p>
      </sec>
      <sec id="heading-bd44abb5f4e83b96fafcd6ba72695f23">
        <title>
          <italic id="italic-d989c926f1762fa5971a7dd41e72c52f">Validity of PCR amplication<italic id="italic-d525e715bde88dc8b6d00520c5b8694b"/></italic>
        </title>
        <p id="paragraph-07987b787442951447fb0a5bf59fcec6">The validity of the PCR amplification of a sample for p.R72P polymorphism were conditioned by amplification of the β-globin gene (260bp) and it is invalid if no bands for β-globin were visible. The P allele is at 177bp and the R allele is at 141bp (Figure 1).</p>
        <fig id="figure-panel-8204e3bc38dedf5486f996242cf03b72">
          <label>Figure 1. Gel Images of P.R72P of TP53 Gene. A, 1-5: allele P. B, 4-5: allele R; 1-3: no amplification allele R; M, Molecular weight marker; bp, base pairs</label>
          <caption>
            <title></title>
            <p id="paragraph-c3c3e2f19bb49e0c171ec7f5e5aee1d6" />
          </caption>
          <graphic id="graphic-2580b632452090bafdecc5416bd56d5e" mimetype="image" mime-subtype="jpeg" xlink:href="http://waocp.com/journal/fig/cb/APJCB_V8_i2_N17_2023_Fig_1.jpg" />
        </fig>
        <p id="paragraph-36c1e45cb557b5ca4fb4650e1c0870c8">For PIN3 Ins16bp polymorphism of the <italic id="italic-47d960c0bf818e5efff688623b3ec0aa">TP53 </italic>gene, the presence of the alleles were conditioned by visualization of bands at 119bp for the A1 allele (wild type) and 135bp for the A2 allele (mutant) (Figure 2).</p>
        <fig id="figure-panel-21a8eee147869a4208b1bda7e01f427e">
          <label>Figure 2. Gel Image of PIN3 Ins16bp; 1 and 3, Heterozygote A1A2; 2,4 and 5, Homozygote A1A1; M, Weight Marker; bp, Base Pairs</label>
          <caption>
            <title></title>
            <p id="paragraph-757fa410dbd8baa0446bfe668c79cc2c" />
          </caption>
          <graphic id="graphic-a9251de81d3c459ee2c4e79339f5d28e" mimetype="image" mime-subtype="jpeg" xlink:href="http://waocp.com/journal/fig/cb/APJCB_V8_i2_N17_2023_Fig_2.jpg" />
        </fig>
        <p id="paragraph-8a7e0a765b710ef46d2f5f0f99de3117">For I157T polymorphism of the <italic id="italic-010f86b9265a286029b3c52d26cb056f">CHEK2 </italic>gene, amplification is valid if the bands were observed at 194bp for the wild type allele (I) and 20bp/170bp for the mutant allele (T) (Figure 3).</p>
        <fig id="figure-panel-e8c2c2f18f653c3f701393f7cdbce0c3">
          <label>Figure 3. Gel of I157T. A, Gel before Digestion, 194bp; B, Gel after Digestion; 1, Mutant Allele (T); 2-5, wild Type Allele (I); M, Molecular Weight Marker ; bp, Base Pairs ; GS, Wild Type; GM, Mutant Genotype</label>
          <caption>
            <title></title>
            <p id="paragraph-38be5a2c5410a14a0475c5e23cda2dcd" />
          </caption>
          <graphic id="graphic-e25a84e070a03b2751af28dcec3dd8f8" mimetype="image" mime-subtype="jpeg" xlink:href="http://waocp.com/journal/fig/cb/APJCB_V8_i2_N17_2023_Fig_3.jpg" />
        </fig>
      </sec>
      <sec id="heading-647cf3b857139f6f1e0b697170795e6e">
        <title>
          <italic id="italic-f89cc19d59f0dabf1831fdbcaf14c487">Statistical analysis<italic id="italic-03b6d504a1e8d12d712f807696594e96"/></italic>
        </title>
        <p id="paragraph-8917b8cbebff2436027f45e28ff886e2">The study data was entered into Excel. Epi Info version 7.1.1.14 (OpenEpi.com.) and Stata version 14.0 (Copyright 1985-2015 StataCorp LP, College Station, Texas 77845 USA) software were used for data analysis. Results were considered statistically significant for p -value ≤ 0.05.</p>
        <p id="paragraph-9c39d677dd757ac25e2f27610793882f">The odds ratio (OR) and the 95% confidence intervals (CI) were calculated using the Epi Info version 7.1.1.14 (OpenEpi.com.) software to estimate associations between the carriage of alleles and certain sociodemographic parameters of breast cancer. The calculation was made by opposing two by two a variable to be studied with a reference variable.</p>
      </sec>
    </sec>
    <sec id="heading-f46fdf5b13f5aaa441560ecb2df8efcc">
      <title>Results </title>
      <sec id="heading-7a12ff5ab548107584a23e333cf27bb5">
        <title>
          <italic id="italic-19b45044bcfeb18426bc89116893b02e">Sociodemographic characteristics of the study population </italic>
        </title>
        <p id="heading-21dff3fdd1fac89dc0cd3c1dc3ee3c76">The study population consisted of 144 women, 65 of whom were cases (breast cancer patients) and 79 controls (non-breast cancer patients). The mean age of the cases was 44.51 ± 8.90 years and that of the controls 37.76 ± 11.01 years. Of all cases, 70.77% were older than 40 years. In addition, our results showed a significant difference between subjects over 40 years old and those under 40 years old (p &lt; 0,001). This confirms previous studies that revealed that more than 40 years older have a higher risk than those with less than 40 years.</p>
        <p id="paragraph-e053a58fb965bb6289bc8ce7825d6110">Also, among the patients, housewives were most represented (39.06%) followed by officials (35.94%) (Table 2).</p>
        <table-wrap id="table-figure-6bc32334f75cd76027764060c49b7a74">
          <label>Table 2. Association between Breast Cancer and Socio-demographic Characteristics</label>
          <caption>
            <title></title>
            <p id="paragraph-4b6527bcaf3f666e588e9243df9b0bec" />
          </caption>
          <table id="table-0d550d7f9545c57641e94891f291c6a6">
            <tbody>
               <tr>
               <td>Subpopulation</td>
               <td>Case</td>
               <td>Controls</td>
               <td>p -value</td>
            </tr>
            <tr>
               <td/>
               <td>n (%)</td>
               <td>n (%)</td>
               <td/>
            </tr>
            <tr>
               <td>age range</td>
               <td/>
               <td/>
               <td/>
            </tr>
            <tr>
               <td>&gt;40 years</td>
               <td>46 (70.77)</td>
               <td>31 (39.74)</td>
               <td/>
            </tr>
            <tr>
               <td>≤40 years</td>
               <td>19 (29.23)</td>
               <td>47 (60.26)</td>
               <td>&lt; 0.001</td>
            </tr>
            <tr>
               <td>Average age (years)</td>
               <td>44.51±8.9</td>
               <td>37.76±11.01</td>
               <td/>
            </tr>
            <tr>
               <td>BMI (kg/m²)</td>
               <td/>
               <td/>
               <td/>
            </tr>
            <tr>
               <td>&lt; 25</td>
               <td>10 (22.73)</td>
               <td>19 (35.19)</td>
               <td/>
            </tr>
            <tr>
               <td>[25;30]</td>
               <td>10 (22.73)</td>
               <td>16 (29.63)</td>
               <td>0.151</td>
            </tr>
            <tr>
               <td>≥30</td>
               <td>24 (54.55)</td>
               <td>19 (35.19)</td>
               <td/>
            </tr>
            <tr>
               <td>Average BMI</td>
               <td>30.4±7.01</td>
               <td>28.29±6.45</td>
               <td>-</td>
            </tr>
            <tr>
               <td>Profession</td>
               <td/>
               <td/>
               <td/>
            </tr>
            <tr>
               <td>Student</td>
               <td>2 (3.13)</td>
               <td>14 (17.95)</td>
               <td/>
            </tr>
            <tr>
               <td>Official</td>
               <td>23 (35.94)</td>
               <td>40 (51.28)</td>
               <td/>
            </tr>
            <tr>
               <td>Housewife</td>
               <td>25 (39.06)</td>
               <td>14 (17.95)</td>
               <td>0.002</td>
            </tr>
            <tr>
               <td>Particular</td>
               <td>13 (20.31)</td>
               <td>8 (10.26)</td>
               <td/>
            </tr>
            <tr>
               <td>Farmer</td>
               <td>1 (1.56)</td>
               <td>2 (2.56)</td>
               <td/>
            </tr>
            <tr>
               <td>Residence</td>
               <td/>
               <td/>
               <td/>
            </tr>
            <tr>
               <td>Urban areas</td>
               <td>61 (93.85)</td>
               <td>79 (100)</td>
               <td/>
            </tr>
            <tr>
               <td>Rural areas</td>
               <td>4 (6.15)</td>
               <td>0 (0)</td>
               <td>0.08</td>
            </tr>
            </tbody>
          </table>
        </table-wrap>
        <p id="paragraph-a5f6843647b9682f70ca55d2524e25ef">The Body Mass Index (BMI) was calculated by taking the ratio of weight to height squared for each woman with these two parameters. According to the criteria of the “US National Institute of Health /National Heart Lung and Blood Institute (NCI/NHLBI)”, the indices were grouped into normal/lean (&lt; 25 kg/m²); overweight (25 and 30 kg/m²) and obese (≥ 30 kg/m²). The patients had a mean BMI of 30.40±7.01 kg/m² and the controls 28.29±6.45 kg/m². Associations between BMI and disease did not show statistically significant results (p=0.151). (Table 2).</p>
      </sec>
      <sec id="heading-d526b6e6a33172934d877707f67b8913">
        <title>
          <italic id="italic-2e901881800904e0b39852a068580c95">Clinical characteristics of the study population<italic id="italic-6cbed6e225fb3399340e6aef4898e3b6"/></italic>
        </title>
        <p id="paragraph-ab050ce619eef4d4ebc4bf8725fa2800">In this study, parity and nulliparity didn’t show statistically significant difference (p&gt;0.05) between cases and controls. Abortion, age at menarche, regularity of the menstrual cycle, age at first child were not also associated with a risk of breast cancer (Table 3). In the first hand, postmenopausal women are more exposed to breast cancer than those who are not yet (Table 3).</p>
        <table-wrap id="table-figure-55ddd9a5b8167e0603bd982fc52db535">
          <label>Table 3. Association between Breast Cancer and Clinical Characteristics</label>
          <caption>
            <title></title>
            <p id="paragraph-fd21216083f1a51d0cc56d55918af6a5" />
          </caption>
          <table id="table-620d179131a7cab9cbf515b502abb1ef">
            <tbody>
               <tr>
               <td>Variables</td>
               <td>Case</td>
               <td>Controls</td>
               <td>OR (95% CI)</td>
               <td>p -value</td>
            </tr>
            <tr>
               <td>Menopausal situation</td>
               <td/>
               <td/>
               <td/>
               <td/>
            </tr>
            <tr>
               <td>Not Post-Menopausal</td>
               <td>37</td>
               <td>64</td>
               <td/>
               <td>Ref</td>
            </tr>
            <tr>
               <td>Menopaused</td>
               <td>28</td>
               <td>15</td>
               <td>3.23 (1.53-6.81)</td>
               <td>0.003</td>
            </tr>
            <tr>
               <td>Menstrual cycle</td>
               <td/>
               <td/>
               <td/>
               <td/>
            </tr>
            <tr>
               <td>Regular</td>
               <td>35</td>
               <td>38</td>
               <td/>
               <td>Ref</td>
            </tr>
            <tr>
               <td>Irregular</td>
               <td>9</td>
               <td>14</td>
               <td>0.7 (0.27-1.81)</td>
               <td>0.617</td>
            </tr>
            <tr>
               <td>Abortion</td>
               <td/>
               <td/>
               <td/>
               <td/>
            </tr>
            <tr>
               <td>Nope</td>
               <td>37</td>
               <td>54</td>
               <td/>
               <td>Ref</td>
            </tr>
            <tr>
               <td>Yes</td>
               <td>28</td>
               <td>25</td>
               <td>1.63 (0.83-3.23)</td>
               <td>0.214</td>
            </tr>
            <tr>
               <td>Age at menarche</td>
               <td/>
               <td/>
               <td/>
               <td/>
            </tr>
            <tr>
               <td>≤ 12 years old</td>
               <td>4</td>
               <td>10</td>
               <td/>
               <td>Ref</td>
            </tr>
            <tr>
               <td>&gt; 12 years</td>
               <td>47</td>
               <td>43</td>
               <td>0.37 (0.11-1.25)</td>
               <td>0.174</td>
            </tr>
            <tr>
               <td>Parity</td>
               <td/>
               <td/>
               <td/>
               <td/>
            </tr>
            <tr>
               <td>Yes</td>
               <td>56</td>
               <td>57</td>
               <td/>
               <td>Ref</td>
            </tr>
            <tr>
               <td>Nope</td>
               <td>9</td>
               <td>22</td>
               <td>0.42(0.18-0.98)</td>
               <td>0.067</td>
            </tr>
            <tr>
               <td>Age at first child</td>
               <td/>
               <td/>
               <td/>
               <td/>
            </tr>
            <tr>
               <td>≤ 30 years old</td>
               <td>48</td>
               <td>46</td>
               <td/>
               <td>Ref</td>
            </tr>
            <tr>
               <td>&gt; 30 years</td>
               <td>8</td>
               <td>9</td>
               <td>0.85 (0.30-2.40)</td>
               <td>0.968</td>
            </tr>
            <tr>
               <td>Exogenous estrogen (contraception)</td>
               <td/>
               <td/>
               <td/>
               <td/>
            </tr>
            <tr>
               <td>Nope</td>
               <td>48</td>
               <td>74</td>
               <td/>
               <td>Ref</td>
            </tr>
            <tr>
               <td>Yes</td>
               <td>17</td>
               <td>5</td>
               <td>5.24 (1.81-15.15)</td>
               <td>0.002</td>
            </tr>
            </tbody>
          </table>
        </table-wrap>
        <p id="paragraph-5c020849a9d7b2ce8e918fbcd5665dfb">Furthermore, compared to those who did not used exogenous estrogens, the users were 5.24 times exposed to the risk of disease, and this difference is statistically significant (p=0.002). Indeed, all the exposed subjects, 77.27% were sick and 22.73% were free from the disease. Elsewhere in the unexposed subjects, 39.34% were affected by the disease and 60.66% were healthy. (Table 3).</p>
        <p id="paragraph-68fb0b5b41cd49fba7cc9074e15475d6">In addition, the average number for parity in this study was 2.3 ± 1.8 children and the average age at first child was about 24 years (24.03 ± 0.61 years).</p>
      </sec>
      <sec id="heading-9b738e1d155694fc259daefb6cc2c793">
        <title>
          <italic id="italic-3f711859e863b444985f484d19463e84">Allelic and genotypic frequencies<italic id="italic-3077966a507dca795b47647d42feee7b"/></italic>
        </title>
        <p id="paragraph-1468582b9d506697df21eab919caae58">The P allele of the p.R72P polymorphism was the most prevalent in 50.77% of cases in our study population. The R allele was present in only 49.23% of the study participants. But, no association between the occurrence of breast cancer and the alleles R and P (OR=0.96; 95%IC (0.59-1.56); p=0.471) were found. The most present genotype of the p.R72P polymorphism was RP (heterozygous) with a proportion of 73.85% for cases and 73.42% for controls. The homozygous (RR) and (PP) genotypes were respectively 12.30% and 13.85% in the cases and 11.39% and 15.18% in the controls. Furthermore, no genotype was statistically associated (RR: OR=0.93; 95% IC (0.29-3.01); p=0.548 and PP: OR=0.84; 95%IC (0.19-3.68); p=0.527) with a risk of breast cancer (Table 4).</p>
        <table-wrap id="table-figure-6361f081f92195373820b08cf98bb0dd">
          <label>Table 4. Distribution of Genotype and Allele Frequencies of Polymorphisms</label>
          <caption>
            <title></title>
            <p id="paragraph-b8f6ae9dd9c4106e1d4c255072bf64cd" />
          </caption>
          <table id="table-33536d3cb8ddbde48822c92041cdd63a">
            <tbody>
               <tr>
               <td> </td>
               <td>Cases</td>
               <td>Controls</td>
               <td>OR (95 % IC)</td>
               <td>P value</td>
            </tr>
            <tr>
               <td> </td>
               <td>N (%)</td>
               <td>N (%)</td>
               <td> </td>
               <td> </td>
            </tr>
            <tr>
               <td>Polymorphism p.R72P of TP53 gene</td>
               <td> </td>
               <td> </td>
               <td> </td>
               <td> </td>
            </tr>
            <tr>
               <td>Genotypes</td>
               <td> </td>
               <td> </td>
               <td> </td>
               <td> </td>
            </tr>
            <tr>
               <td>RR</td>
               <td>8 (12.31)</td>
               <td>9 (11.39)</td>
               <td>-</td>
               <td>Reference</td>
            </tr>
            <tr>
               <td>RP</td>
               <td>48 (73.61)</td>
               <td>58 (73.42)</td>
               <td>0.93 (0.29-3.01)</td>
               <td>0.548</td>
            </tr>
            <tr>
               <td>PP</td>
               <td>9 (13.85)</td>
               <td>12 (15.19)</td>
               <td>0.84 (0.19-3.68)</td>
               <td>0.527</td>
            </tr>
            <tr>
               <td>Alleles</td>
               <td> </td>
               <td> </td>
               <td> </td>
               <td> </td>
            </tr>
            <tr>
               <td>R</td>
               <td>64 (49.23)</td>
               <td>76 (48.10)</td>
               <td>-</td>
               <td>Reference</td>
            </tr>
            <tr>
               <td>P</td>
               <td>66 (50.77)</td>
               <td>82 (51.90)</td>
               <td>0.96 (0.59-1.56)</td>
               <td>0.471</td>
            </tr>
            <tr>
               <td>Genetic model of transmission of the mutated allele</td>
               <td> </td>
               <td> </td>
               <td> </td>
               <td> </td>
            </tr>
            <tr>
               <td>PP vs RP+ PP (Rec)</td>
               <td>-</td>
               <td>-</td>
               <td>0.9 (0.31-2.52)</td>
               <td>0.82</td>
            </tr>
            <tr>
               <td>PP+RP vs RR (Dom)</td>
               <td>-</td>
               <td>-</td>
               <td>0.92 (0.29-2.92)</td>
               <td>0.866</td>
            </tr>
            <tr>
               <td>Polymorphism PIN3 Ins16bp of TP53 gene</td>
               <td> </td>
               <td> </td>
               <td> </td>
               <td> </td>
            </tr>
            <tr>
               <td>Genotypes</td>
               <td> </td>
               <td> </td>
               <td> </td>
               <td> </td>
            </tr>
            <tr>
               <td>A1A1</td>
               <td>35 (53.85)</td>
               <td>48 (60.76)</td>
               <td>-</td>
               <td>Reference</td>
            </tr>
            <tr>
               <td>A1A2</td>
               <td>29 (44.62)</td>
               <td>27 (34.18)</td>
               <td>1.47 (0.70-3.08)</td>
               <td>0.173</td>
            </tr>
            <tr>
               <td>A2A2</td>
               <td>1 (1.54)</td>
               <td>4 (5.06)</td>
               <td>0.34 (0.01-3.7)</td>
               <td>0.315</td>
            </tr>
            <tr>
               <td>Alleles</td>
               <td> </td>
               <td> </td>
               <td> </td>
               <td> </td>
            </tr>
            <tr>
               <td>A1</td>
               <td>99 (76.15)</td>
               <td>123 (77.85)</td>
               <td>-</td>
               <td>Reference</td>
            </tr>
            <tr>
               <td>A2</td>
               <td>31 (23.85)</td>
               <td>35 (22.15)</td>
               <td>1.1 (0.61-1.98)</td>
               <td>0.42</td>
            </tr>
            <tr>
               <td>Genetic model of transmission of the mutated allele</td>
               <td> </td>
               <td> </td>
               <td> </td>
               <td> </td>
            </tr>
            <tr>
               <td>A2A2 vs A1A2+ A2A2 (Rec)</td>
               <td>-</td>
               <td>-</td>
               <td>0.29 (0.01-3.08)</td>
               <td>0.25</td>
            </tr>
            <tr>
               <td>A2A2+A1A2 vsA1A1 (Dom)</td>
               <td>-</td>
               <td>-</td>
               <td>1.33 (0.65-2.72)</td>
               <td>0.403</td>
            </tr>
            <tr>
               <td>Polymorphism I157T of CHEK2 gene</td>
               <td> </td>
               <td> </td>
               <td> </td>
               <td> </td>
            </tr>
            <tr>
               <td>Genotypes</td>
               <td> </td>
               <td> </td>
               <td> </td>
               <td> </td>
            </tr>
            <tr>
               <td>II</td>
               <td>64 (98.46)</td>
               <td>79 (100)</td>
               <td>-</td>
               <td>Reference</td>
            </tr>
            <tr>
               <td>IT</td>
               <td>0 (0)</td>
               <td>0 (0)</td>
               <td>NA</td>
               <td>-</td>
            </tr>
            <tr>
               <td>TT</td>
               <td>1 (1.54)</td>
               <td>0 (0)</td>
               <td>NA</td>
               <td>-</td>
            </tr>
            <tr>
               <td>Alleles</td>
               <td> </td>
               <td> </td>
               <td> </td>
               <td> </td>
            </tr>
            <tr>
               <td>I</td>
               <td>128 (98.46)</td>
               <td>158 (100)</td>
               <td>-</td>
               <td>Reference</td>
            </tr>
            <tr>
               <td>T</td>
               <td>2 (1.54)</td>
               <td>0 (0)</td>
               <td>NA</td>
               <td>-</td>
            </tr>
            <tr>
               <td>Genetic model of transmission of the mutated allele</td>
               <td> </td>
               <td> </td>
               <td> </td>
               <td> </td>
            </tr>
            <tr>
               <td>TT vs IT+ TT (Rec)</td>
               <td>-</td>
               <td>-</td>
               <td>NA</td>
               <td>-</td>
            </tr>
            <tr>
               <td>TT+IT vs II (Dom)</td>
               <td>-</td>
               <td>-</td>
               <td>NA</td>
               <td>-</td>
            </tr>
            </tbody>
          </table>
        </table-wrap>
        <p id="paragraph-9934b9383ac39280663c03b20e38b458">Dom, dominant; Rec, recessive ; OR, Odd Ratio; 95%IC, 95% confidence interval</p>
        <p id="paragraph-93abc9dde5194275dc68b09cf20fe05c">As for the PIN3 Ins16bp polymorphism, the most present allele was the wild type A1 with a proportion of 76.15%. The A2 mutant allele was present in only 23.85% of the study population. Furthermore, we did not find any risk associated with carrying both A1 and A2 alleles (OR= 1.1; 95%IC (0.61-1.98); p=0.420).</p>
        <p id="paragraph-89631fea7d54681c182456d63cfeb4cb">The A1A1 (homozygous wild type) genotype was the most present with a proportion of 53.85% in cases and 60.76% in controls. The A1A2 (heterozygous) and A2A2 (homozygous mutant) genotypes were respectively 44.62% and 1.54% for cases and 34.18% and 5.06% for controls. Here also, no genotype was statistically associated (A1A2: OR=1.47; 95%IC (0.70-3.08); p=0.173 and A2A2: OR=0.34 ;95%IC (0.01-3.7) t; p=0.315) with breast cancer risk in this study (Table 4).</p>
        <p id="paragraph-509249de159422540be2a4dac381e731">Finally, for the I157T mutation, the mutant allele (T) was very rare (1.54%) in the cases and none control had the mutation. The wild-type allele (I) had a majority proportion of 98.46% in the cases and 100% in the controls. The most present genotype was the homozygous wild type (II) with a proportion of 98.46% in the cases and 100% in the controls in our study population. There were no heterozygous individuals (IT) in either the cases or controls. Only one (01) patient was homozygous mutant (TT). No controls had the mutation (Table 4).</p>
      </sec>
      <sec id="heading-cd719ced02543969200b5243b13343b3">
        <title>
          <italic id="italic-25ba8b994c1d71a07ecac47972944524">Combined genotypes and the risk of developing breast cancer<italic id="italic-23b1bec1fab8c668b3269413ed49b9be"/></italic>
        </title>
        <p id="heading-66aa1162292ed9d98ee49cf258769415">We wanted to know if combined genotypes would increase the risk of developing breast cancer. Then, we paired the polymorphisms p.R72P and PIN3 Ins16bp of <italic id="italic-743ade2a8f762eba45a11cf08a32726c">TP53</italic>. None of the combined polymorphism genotypes were associated with development (p&gt;0.05) (Table 5).</p>
        <table-wrap id="table-figure-0fac1e217063c1827bcc767b3f0735f8">
          <label>Table 5. Combined Association between the Presence of two Polymorphisms and Breast Cancer</label>
          <caption>
            <title></title>
            <p id="paragraph-bcfa7f3ee923ad95871b66f5063db615" />
          </caption>
          <table id="table-f0b52baf8c32d5de277f2d020da30e92">
            <tbody>
              <tr>
               <td>Genotypes</td>
               <td>Controls</td>
               <td>Cases</td>
               <td>OR</td>
               <td>95%IC</td>
               <td>P-value</td>
            </tr>
            <tr>
               <td> </td>
               <td>N (%)</td>
               <td>N (%)</td>
               <td> </td>
               <td> </td>
               <td> </td>
            </tr>
            <tr>
               <td>TP53 p.R72P and TP53 PIN3 Ins16bp</td>
               <td> </td>
               <td> </td>
               <td> </td>
               <td> </td>
               <td> </td>
            </tr>
            <tr>
               <td>RR-A1A1</td>
               <td>9 (11,39)</td>
               <td>6 (9,23)</td>
               <td> </td>
               <td> </td>
               <td>Ref</td>
            </tr>
            <tr>
               <td>RR-A1A2</td>
               <td>-</td>
               <td>2 (3,08)</td>
               <td>NA</td>
               <td>NA</td>
               <td>-</td>
            </tr>
            <tr>
               <td>RP-A1A1</td>
               <td>34 (43,04)</td>
               <td>25 (38,46)</td>
               <td>1.1</td>
               <td>0.35-3.5</td>
               <td>0.9</td>
            </tr>
            <tr>
               <td>RP-A1A2</td>
               <td>20 (25,32)</td>
               <td>23 (35,38)</td>
               <td>1.73</td>
               <td>0.52-5.69</td>
               <td>0.549</td>
            </tr>
            <tr>
               <td>RP-A2A2</td>
               <td>4 (5,06)</td>
               <td>-</td>
               <td>NA</td>
               <td>NA</td>
               <td>-</td>
            </tr>
            <tr>
               <td>PP-A1A1</td>
               <td>5 (6,33)</td>
               <td>4 (6,15)</td>
               <td>1.2</td>
               <td>0.23-6.39</td>
               <td>0.831</td>
            </tr>
            <tr>
               <td>PP-A1A2</td>
               <td>7 (8,86)</td>
               <td>4 (6,15)</td>
               <td>0.86</td>
               <td>0.17-4.27</td>
               <td>0.826</td>
            </tr>
            <tr>
               <td>PP-A2A2</td>
               <td>-</td>
               <td>1 (1,54)</td>
               <td>NA</td>
               <td>NA</td>
               <td>-</td>
            </tr>
            </tbody>
          </table>
        </table-wrap>
        <p id="paragraph-4e2197a281bc96d68b089c25654dfd34">NA, not applicable; OR, Odds Ratio; 95%CI, 95% confidence interval</p>
        <p id="heading-c940b8d6e279a5fdb2421584698e17ea" />
      </sec>
    </sec>
    <sec id="heading-b56ec1ca00251ab62e3467f33091f78b">
      <title>Discussion</title>
      <sec id="heading-d85962f897f5fe89c24958ceef8cffc1">
        <title>
          <italic id="italic-c4c9b534a9159c11abeca5c725e99650">Sociodemographic data<italic id="italic-e7fb287632f265ab30ad391880ebc130"/></italic>
        </title>
        <p id="heading-af74b5563ef55ba4d8c4eee803d104c6">The mean age of patients in our study population was 44.51±8.9 years which is lower than those found by Bambara et al., (2017) [3] which was 48.20 ± 12.4 years and by Zongo et al., (2021) [2] which was 47.5 years in Burkina Faso. The mean age of patients seems to decrease over the years.</p>
        <p id="paragraph-952e7a0519e4d19e780641b436d2e73c">In this study, only 6.15% of the patients lived in rural areas. A study in Nigeria showed that urban dwellers who were in daily contact with exhaust fumes and industrial waste were at higher risk of breast cancer than those who were not (OR=6.91; p=0.00), including rural dwellers [28]. In addition, Ba et al., (2020) [29] showed the difficulties of rural women to consult a health practitioner for their health problems in sub-Saharan Africa. All of these observations could explain the trend of high breast cancer prevalence in African cities compared to low rates of breast cancer in rural areas.</p>
        <p id="paragraph-7c1a48cc3907242cef853e4ab4e09533">In this study, the association between BMI and disease did not show a significant difference (p=0.151) but we found that the mean BMI of the patients was slightly higher (30.4±7.01 kg/m²) than that of the controls (28.29±6.45 kg/m²). Some previous studies have associated obesity with an increased risk of breast cancer [30], other studies haven’t found obesity to be associated with a risk of breast cancer in Burkina Faso [31].</p>
      </sec>
      <sec id="heading-4056882129f4d713ae749390d28aeaf9">
        <title>
          <italic id="italic-446bafd493f1460485d13a6ad665f5d7">Reproductive Factors<italic id="italic-ad6a440f06ffe3d2483dfe1524c30e80"/></italic>
        </title>
        <p id="paragraph-72eb83d1690258f872b672d80afe353a">The average number for parity in this study is 2.3 ± 1.8 children and the mean age at first birth was about 24 years (24.03 ± 0.61 years). In the past, African women were characterized by an advanced age at menarche (after 15 years); the birth of the first child at a relatively early age (around 19 years old) and by a relatively high multiparity (5 to 9 children per woman), which would protect them from breast cancer [32]. But the adoption of Western lifestyles nowadays contributes to the regression of these protective factors among African women [33]. This last observation is a reality in our study population.</p>
        <p id="paragraph-9bd605bf853552f5b5f0347be1adfaad">In our study, associations between nulliparity and multiparity were not associated with the disease occurrence (p=0.067). On the other hand, multiparity is often associated with protection and nulliparity with a risk of breast cancer. Full-term pregnancy and breastfeeding have been shown to contribute to a decrease in estrogen levels and increases this protection against the development of breast cancer [34].</p>
        <p id="paragraph-58cc8c6f1cad802f666a424b8d4f3f45">Our results do not indicate a significant difference (p=0.174) between the age at menarche, the irregularity of the menstrual cycle and the development of breast cancer. Our results confirms that of a nigerian study [35] who found no association between age at menarche; parity and risk of developing breast cancer in a study of a cohort of 2000 Nigerian participants. But other studies have reported that an early menarche before the age of 12 increases the risk of developing breast cancer [36].</p>
        <p id="paragraph-644227441d7de252e995b362dd91d169">We also associated the menopausal situation with the disease. Menopause would increase the risk of developing the disease (p=0.002). Among postmenopausal women, patients were 65.12% versus 34.88% for controls and among women who had not yet reached menopausal age, patients were 36.63% versus 63.37 % for controls. This result confirms what Sun et al., reported in 2017 that the risk of breast cancer increases by 3% each year after menopause [37]. But other studies did not find a direct association between breast cancer and age at menopause [38].</p>
      </sec>
      <sec id="heading-bf804d514d2bcaeb8814c8b599ae023f">
        <title>
          <italic id="italic-24269fd88f2e58305c2b013be8d69e90">Allelic and genotypic frequencies of the p.R72P, PIN3 Ins16bp and I157T polymorphisms</italic>
        </title>
        <p id="heading-310b581b525f79ce192b4fc52bd467ea">Our results show that the P allele of the p.R72P polymorphism was the most frequent in both cases (50.77%) and controls (51.90%) and the R allele had a proportion of 49.34% and 48.10% in cases and controls respectively but no association were found between an allele of this polymorphism and breast cancer. In Tunisian population, a study [39] have not found also association between an allele of the R72P polymorphism and breast cancer but it have showed that the R allele was the frequent in both cases (75%) and controls (65.3%). Out of Africa, our frequencies are slightly different from those obtained by a study in an Indian population [7] where the R allele was most frequent in controls (53.8%) and the P allele most frequent in cases (56.9%). Here also, none allele were associated with brest cancer. In addition, the P allele has been associated with the risk of developing colorectal cancer in the Japanese [40], Korean [41], Chinese [42] and Malaysian [43] population while the R allele has been associated with the risk of developing breast cancer in Greece [44]. It is also reported that the R allele induces apoptosis more efficiently than the P allele [8,45,46]. On the other hand, the P variant is more effective in inducing cell cycle arrest in the G1 phase, allowing better repair of damaged DNA [8,47].</p>
        <p id="paragraph-a24adf7f5a80c607557dcf5e4230f395">At the genotypic level, the heterozygous genotype (RP) was in the majority in both cases (73.85%) and controls (73.41%) but none genotype were associated with breast cancer. These results are different to those of Guleria et al (2012) [7] in India where heterozygotes were 58.8% in cases and 40% in controls; no association were also reported. Furthermore, the association of PP genotype and increased risk of breast [48], colorectal [49], bladder cancer in the North Indian population have been reported. However, no association was found between breast cancer and the p.R72P polymorphism in Tunisian [39] and Russian [50] patients.</p>
        <p id="paragraph-b5463575b4d3366d2f0dd3f388fddcec">As for the PIN3 Ins16bp polymorphism, the A1 (wild type) allele was the most frequent in both cases (76.15%) and controls (77.85%) and the A2 (mutant) allele had a proportion of 23.85% and 22.15% respectively in cases and controls. We have not found a study in Africa on this polymorphism but these frequencies are similar to those obtained in a study in an Indian population [7] where the A1 allele was the most frequent in both patients (72.5%) and controls (81.9%). The A2 allele had a proportion of 27.5% and 18.1% in cases and controls respectively. At the genotypic level, the wild type (A1A1) was the majority in both cases (53.85%) and controls (60.76%). These results are similar to those of Guleria et al. (2012) in India where wild-type genotypes were the most frequent (53.8% in cases and 66.3% in controls) [7]. The A2A2 genotype has been reported as a risk for the development of breast cancer [51] . Also a high risk of A1A2 genotype in the development of breast cancer has been reported in Iranian population [52]. It is reported that the PIN3 Ins16bp polymorphism is a duplication of 16 base pairs in intron 3 of <italic id="italic-d7f1f001344f6332e26ae23b3a920432">TP53 </italic>gene. It affects mRNA splicing, altering coding regions [7]. The involvement of this polymorphism in cancers such as colon cancer [16] and breast [17] is a consequence of its association to the reduction of p53 mRNA level and decreased apoptotic indices as well as DNA repair capacity in lymphoblastoid cell lines [16].</p>
        <p id="paragraph-3be2c9981f10c24c65984d45751ae6a5">Finally, for the I157T mutation of the <italic id="italic-ed23cd22c925df24b10b596fb61559a0">CHEK2 </italic>gene, it was found in only one patient in our population. Similarly, the I157T mutation has not been identified in different populations [27,53,54] . Moreover, this mutation has not been associated with an increased risk in the Moroccan population [55]. On the other hand, a large study [56] reported the c.1343T&gt;G mutation of <italic id="italic-abcd3b24156e5348536555e3c175a5d3">CHEK2 </italic>in African subjects. This mutation was associated with a risk of prostate cancer in African men. In this same study three (03) mutations of <italic id="italic-db0cd0f97c56db4589e55c5d90a2b01a">CHEK2 </italic>gene including c.349A&gt; G; c.1036C&gt;T; c.538C&gt;T was associated with breast cancer risk in European women and the c.1312G&gt;T mutation was associated with prostate cancer risk in European men [56]. We did not find an African study reporting the presence of this mutation in Africa. It is reported that following a break in the double-stranded DNA via the action of an ionizing agent or a genotoxic substance, <italic id="italic-dc0b2858a18500abcb7636a9ab21d668">CHEK2 </italic>will be activated by phosphorylation and homodimerization by <italic id="italic-f5f0a988e350893b838ba0298ac1b374">ATM </italic>kinase. After the activation of <italic id="italic-9534da3ee467c6002e23772ff9b3bb2c">CHEK2</italic>, this molecule will activate other molecules such as p53, <italic id="italic-73a7cb7b1867d680930804a1d40e496c">BRCA1</italic>, Cdc25A and Cdc25C. Activation of p53 by activated <italic id="italic-d2a5bdec3023a4194286cae0df49f54e">CHEK2 </italic>occurs through phosphorylation of p53 which stabilizes the p53 molecule [19,20]. All this results in consequences such as cell arrest in G1, S and G2/M or activation of DNA repair or apoptosis in certain cases. Thus, the I157T mutation of the <italic id="italic-b2e59ef344a98005d71dc272349c13c8">CHEK2 </italic>gene produces a protein that is stable but unable to recognize p53, Cdc25 and <italic id="italic-37262b22a4b871c496727c72bfa34dea">BRCA1</italic>. This mutation takes place at the level of exon 3 [57] and leads to the formation of tumors by a dominant negative effect rather than by dysfunction [20].</p>
        <p id="paragraph-748761ccae561224609a17bc9302d063">In this study, none of these polymorphisms have been directly associated with the risk of developing breast cancer. Thus, the p.R72P and PIN3 Ins16bp polymorphisms of the <italic id="italic-0b650d478c3636675692594762713c00">TP53 </italic>gene as well as the I157T mutation of the <italic id="italic-b793bae6f40ae748b0a4a3ee8a012a55">CHEK2 </italic>gene do not appear to be genetic factors involved in the development of breast cancer in our study population. But muticenter studies and on large samples are needed before extending this result at national level.</p>
      </sec>
      <sec id="heading-e11ee5cc6c51029985439a021d49ce6f">
        <title>
          <italic id="italic-c4c276ad8d7fb84c387759324a29da6b">Associated genotypes<italic id="italic-268c927473c359619d4af6feaec4f942"/></italic>
        </title>
        <p id="paragraph-342542a4730929193d5a4b946421959b">Generally, the effect of a single SNP is weak to implicate a pathology but the combined effects of aberrant SNPs may contribute additively or synergistically to a risk of developing a pathology. In our study, the polymorphisms p.R72P, PIN3 Ins16bp and I157T associated two by two in correlation with the development of breast cancer did not show significant differences (p&gt;0.05). We have not found previous studies regarding the association between p.R72P, PIN3 Ins16bp and I157T polymorphisms in breast cancer. The no association between the combined genotypes and the deseases can be justified by the relatively small sample size that influences the statistical power.</p>
      </sec>
      <sec id="heading-d0721a651c6a9f97a5fc7a940bc664e7">
        <title>
          <italic id="italic-0bd50e6bd36b8c55a8a7059519542e29">Limits of this study<italic id="italic-c0dfaecce25ce75f89cfc74352c6b95a"/></italic>
        </title>
        <p id="paragraph-80877ae63323a68d3db348c0c9c739fb">Despite all the efforts made, this study had some limits as the reduced size of the sample. Also, some clinicopathological parameters were not found in the medical records of patients, which weakened the multivariate analysis. The ages between patients and controls were not matched. Also, the subjects of this studies came from hospitals in the only city of Ouagadougou. For future investigations, several cities must be included in the study.</p>
      </sec>
      <sec id="heading-a1ff23dd8137a44da05f5f9f99b69304">
        <title>
          <italic id="italic-495b0a9c491d57202a0a522ae91ee700">Perspectives and Challenges<italic id="italic-0a3636d148ab6999495f400974775234"/></italic>
        </title>
        <p id="paragraph-e3d0cfa96b5d7be91f78730e046914be">We have in prospects to extend this study to several cities in Burkina Faso to clearly establish the involvement of these polymorphism in development of breast cancer at national level. In addition does not there be a way to restore the alterations of <italic id="italic-e7391e6e0e8813d9df136b3bc51a40b1">TP53 </italic>gene of sporadic cancers? This is a question that we will try to answer in our future studies.</p>
        <p id="paragraph-5b97bf70a705cbd09941f0bec0880160">In conclusion, this study showed that the allele P of the p.R72P polymorphism and the wild-type allele (A1) of the PIN3 Ins16bp polymorphism were in the majority. As for the I157T mutation, it was very rare in our study population. In short, in our study, none of these polymorphisms were associated with the risk of developing breast cancer, so they do not appear to be genetic factors involved in the development of breast cancer in our study population. However, given the small size of our population, other investigations of the <italic id="italic-a9ce9ce747c94980695e10a720563d15">TP53 </italic>and <italic id="italic-dcb397b0a836c09646dc005bfcab2fc5">CHEK2 </italic>genes in a large population may help to provide definitive informations.</p>
      </sec>
    </sec>
    <sec id="heading-082cef889a551cd51d7c4f1f24aec291">
      <title>Acknowledgements</title>
      <p id="paragraph-1">The authors sincerely acknowledge all the participants (cases and controls), Laboratory of Molecular and Genetic Biology (LABIOGENE) and Pietro Annigoni Biomolecular Research Center (CERBA), for their valuable contribution to the successful completion of the study.</p>
      <sec id="heading-7629375fa70689b93f8bacfdea7d1cf2">
        <title>
          <italic id="italic-4c10f350ce9c3ca8ea6b8f1a1ee19c3c">Statement<italic id="italic-0465ce06e3ce43d779c8760d61b385a5"/></italic>
        </title>
        <p id="paragraph-194e51123770134b1aa08a48cabf1adf">This manuscript has been published as a preprint according to the following link: <ext-link id="external-link-1" ext-link-type="uri" xlink:href="http://www/">https://www</ext-link>. researchsquare.com/article/rs-1693953/v1 ORCID link of the corresponding author: https://orcid. org/0000-0002-9423-024X.</p>
      </sec>
      <sec id="heading-0aa1129f2603b93b36f64b0168d6605f">
        <title>
          <italic id="italic-cd9bc9a4d93e0ca35dd471ce5c7304df">Ethics approval and consent to participate<italic id="italic-dd2e74f36b629a3e560a68068f8a6624"/></italic>
        </title>
        <p id="paragraph-b739084998ce9c2e612bf904f8372e70">Our study obtained approval from the Health Research Ethics Committee (CERS) of Burkina Faso (Deliberation No. 2019-5-067 of 15 May 2019). All participants gave their free and informed consent. We scrupulously respected confidentiality and anonymity. A written consent were obtained from every patient and control.</p>
      </sec>
      <sec id="heading-101edba7db07ad88e2c8d3a9b4462c40">
        <title>
          <italic id="italic-36a6aac3ab2404c59755171ba8e4442f">Availability of data and material<italic id="italic-51fc1ce1cbd30927db4e149e15643ed5"/></italic>
        </title>
        <p id="paragraph-2b438558f3eb4fefc22461b9c8be9e50">The data used in this study are available and will be provided by the corresponding author on a reasonable request.</p>
        <p id="paragraph-2937a609aaee4293762dcbc0617232d1" />
      </sec>
      <sec id="heading-92e438af0e94583ad54e1fd777808a35">
        <title>
          <italic id="italic-73918bfd42529495c9640b481e50d7f0">Competing interests<italic id="italic-a1febe7e6af357e6fd41a40d625aae0e"/></italic>
        </title>
        <p id="paragraph-eedd7f9a00ba4470295ceda156002def">The authors declare that they have no conflict of interest.</p>
        <p id="paragraph-11eb24aed3909ff33d8682d9a47a56a3" />
      </sec>
      <sec id="heading-7b0928ad399a634dd7aefb726131c8d2">
        <title>
          <italic id="italic-6f86d5549c85495c101a5910b66ca702">Funding statement<italic id="italic-3b91cf1b8264847f883fb239ac4bba87"/></italic>
        </title>
        <p id="paragraph-9">No funding announcement.</p>
        <p id="paragraph-10" />
      </sec>
      <sec id="heading-c28049ebab026e014b73e865ed91f4e0">
        <title>
          <italic id="italic-8546bbd17499333582d3246d81c1f1a5">Authors’ contributions<italic id="italic-862c380104af2cf0ef5022dfc0a0b966"/></italic>
        </title>
        <p id="paragraph-12">Conceptualization, JS, AAZ and SD; Methodology: SD, AAZ, TIK, LJA, HKS, MDWA, BSB, LT, TCO and RAO; Formal analysis and investigation: SD, AAZ, HKS, TIK, MDWA and LT; Writing-original draft preparation: AAZ and SD; Writing-review and editing: TIK, LJA,HKS, MDWA, BSB, LT, TCO, RAO, NZ, TMZ, ATY, AYS and FWD; patient enrolment: NZ, AYS, ITK and LJA. Supervision: ATY and JS.</p>
        <p id="paragraph-15">All authors were the major contributors in writing the manuscript. All authors read and approved the final manuscript.</p>
        <p id="paragraph-16" />
      </sec>
    </sec>
    <sec id="heading-7d6edf43491e259d7eb6fbc425dde9b5">
      <title>References</title>
      <p id="heading-daebe60f1e8940e41e0e8af5795248e7" />
    </sec>
  </body>
  <back>
    <ref-list>
      <ref id="journal-article-ref-12acda231a70ea59914603a69456a9d0">
        <element-citation publication-type="journal">
          <article-title>GLOBOCAN [Internet]. GLOBOCAN, 20202020 [cité 2021 févr 23];Available from: http://gco.iarc.fr/today/home</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-1c9aa6bf0caf656c87b033129c16b368">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Zongo</surname>
              <given-names>N</given-names>
            </name>
            <name>
              <surname>Ouédraogo</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Ouédraogo</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Sanon-Lompo</surname>
              <given-names>S</given-names>
            </name>
            <collab>
              <named-content content-type="name">Ido FA</named-content>
            </collab>
            <name>
              <surname>Djiguemdé</surname>
              <given-names>A</given-names>
            </name>
            <collab>
              <named-content content-type="name">et al</named-content>
            </collab>
          </person-group>
          <source>BURKINA MEDICAL 2021;25:15</source>
          <article-title>Incidences et évolution des fréquences des cancers au Burkina Faso de 1988 à 2018</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-b6d741a4ec72866ec45112e3357153f7">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <collab>
              <named-content content-type="name">Bambara HA</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Zouré AA</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Sawadogo AY</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Ouattara AK</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Marie NL</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Traoré SS</named-content>
            </collab>
            <collab>
              <named-content content-type="name">et al</named-content>
            </collab>
          </person-group>
          <source>Pan Afr Med J [Internet] 2017 [cité 2021 juin 21];28. Available from: http://www.panafrican-med-journal.com/content/article/28/314/full/</source>
          <article-title>Breast cancer: descriptive profile of 80 women attending breast cancer care in the Department of General and Digestive Surgery of CHU-YO</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-64d0103f8f9295be3c9693a479a461dd">
        <element-citation publication-type="journal">
          <article-title>Ministere De La Sante Burkina Faso. Plan Strategique De Lutte Contre Le Cancer 2013 - 2017. 2013;74</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-571ec075aedbbb6e646f7ada834ab4ad">
        <element-citation publication-type="journal">
          <issue>3</issue>
          <month>03</month>
          <page-range>133-140</page-range>
          <volume>2</volume>
          <year>2001</year>
          <pub-id pub-id-type="doi">10.1016/S1470-2045(00)00254-0</pub-id>
          <person-group person-group-type="author">
            <collab>
              <named-content content-type="name">Key TJ</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Verkasalo PK</named-content>
            </collab>
            <name>
              <surname>Banks</surname>
              <given-names>E</given-names>
            </name>
          </person-group>
          <source>The Lancet. Oncology</source>
          <article-title>Epidemiology of breast cancer</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-6707501904dc781277bbfbfd376a3087">
        <element-citation publication-type="journal">
          <issue>3</issue>
          <page-range>369-374</page-range>
          <volume>7</volume>
          <year>2006</year>
          <person-group person-group-type="author">
            <name>
              <surname>Yip CH</surname>
              <given-names>Cheng Har</given-names>
            </name>
            <name>
              <surname>Taib NAM</surname>
              <given-names>Nur Aishah Mohd</given-names>
            </name>
            <name>
              <surname>Mohamed</surname>
              <given-names>I</given-names>
            </name>
          </person-group>
          <source>Asian Pacific journal of cancer prevention: APJCP</source>
          <article-title>Epidemiology of breast cancer in Malaysia</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-211e58db11b0ae11c4a6d92b17186b28">
        <element-citation publication-type="journal">
          <issue>7</issue>
          <page-range>3305-3311</page-range>
          <volume>13</volume>
          <year>2012</year>
          <pub-id pub-id-type="doi">10.7314/apjcp.2012.13.7.3305</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Guleria</surname>
              <given-names>K</given-names>
            </name>
            <name>
              <surname>Sharma</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Manjari</surname>
              <given-names>M</given-names>
            </name>
            <collab>
              <named-content content-type="name">Uppal MS</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Singh NR</named-content>
            </collab>
            <name>
              <surname>Sambyal</surname>
              <given-names>V</given-names>
            </name>
          </person-group>
          <source>Asian Pacific journal of cancer prevention: APJCP</source>
          <article-title>p.R72P, PIN3 Ins16bp polymorphisms of TP53 and CCR5?32 in north Indian breast cancer patients</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-a4f6f3751f7a23cd33da1e91a3d6d6dc">
        <element-citation publication-type="journal">
          <issue>16</issue>
          <page-range>6871-6879</page-range>
          <volume>15</volume>
          <year>2014</year>
          <pub-id pub-id-type="doi">10.7314/apjcp.2014.15.16.6871</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Sharma</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Sambyal</surname>
              <given-names>V</given-names>
            </name>
            <name>
              <surname>Guleria</surname>
              <given-names>K</given-names>
            </name>
            <name>
              <surname>Manjari</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Sudan</surname>
              <given-names>M</given-names>
            </name>
            <collab>
              <named-content content-type="name">Uppal MS</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Singh NR</named-content>
            </collab>
            <name>
              <surname>Bansal</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Gupta</surname>
              <given-names>A</given-names>
            </name>
          </person-group>
          <source>Asian Pacific journal of cancer prevention: APJCP</source>
          <article-title>TP53 polymorphisms in sporadic North Indian breast cancer patients</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-238a7bd7639188b2901bea08e9ceac7a">
        <element-citation publication-type="journal">
          <issue>11</issue>
          <month>11</month>
          <page-range>1021-1023</page-range>
          <volume>23</volume>
          <year>2007</year>
          <pub-id pub-id-type="doi">10.1051/medsci/200723111021</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Lehmann-Che</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Turpin</surname>
              <given-names>E</given-names>
            </name>
            <name>
              <surname>Bertheau</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Espié</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Thé</surname>
              <given-names>H</given-names>
            </name>
          </person-group>
          <source>Medecine Sciences: M/S</source>
          <article-title>[Exquisite sensitivity of TP53 mutant breast cancers to dose-dense chemotherapy]</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-c7bd7575a85dd7600d3129fff1c18cb2">
        <element-citation publication-type="journal">
          <issue>10</issue>
          <month>10</month>
          <page-range>749-758</page-range>
          <volume>9</volume>
          <year>2009</year>
          <pub-id pub-id-type="doi">10.1038/nrc2723</pub-id>
          <person-group person-group-type="author">
            <collab>
              <named-content content-type="name">Levine AJ</named-content>
            </collab>
            <name>
              <surname>Oren M</surname>
              <given-names>M</given-names>
            </name>
          </person-group>
          <source>Nature Reviews. Cancer</source>
          <article-title>The first 30 years of p53: growing ever more complex</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-8394ba005ee786086c05192e839b261a">
        <element-citation publication-type="journal">
          <issue>2</issue>
          <month>02</month>
          <page-range>114-125</page-range>
          <volume>331</volume>
          <year>2008</year>
          <pub-id pub-id-type="doi">10.1016/j.crvi.2007.03.003</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Tubiana</surname>
              <given-names>M</given-names>
            </name>
          </person-group>
          <source>Comptes Rendus Biologies</source>
          <article-title>[Generalities about carcinogenesis]</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-79062fa8a870f52098dee6fe822ce9f7">
        <element-citation publication-type="journal">
          <issue>2</issue>
          <month>03</month>
          <page-range>77-86</page-range>
          <volume>9</volume>
          <year>2005</year>
          <pub-id pub-id-type="doi">10.1016/j.canrad.2004.11.003</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Delaloge</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Marsiglia</surname>
              <given-names>H</given-names>
            </name>
          </person-group>
          <source>Cancer Radiotherapie: Journal De La Societe Francaise De Radiotherapie Oncologique</source>
          <article-title>[Genetic bases of the radiosensitivity of breast cancer]</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-f2fd672cd7cdb37f779845c41fffffac">
        <element-citation publication-type="journal">
          <day>10</day>
          <issue>3</issue>
          <month>06</month>
          <page-range>834-842</page-range>
          <volume>331</volume>
          <year>2005</year>
          <pub-id pub-id-type="doi">10.1016/j.bbrc.2005.03.190</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Soussi</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Lozano</surname>
              <given-names>G</given-names>
            </name>
          </person-group>
          <source>Biochemical and Biophysical Research Communications</source>
          <article-title>p53 mutation heterogeneity in cancer</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-eda4a48cef0787ae449e740beb4734ae">
        <element-citation publication-type="journal">
          <day>01</day>
          <issue>7</issue>
          <month>10</month>
          <page-range>1481-1486</page-range>
          <volume>121</volume>
          <year>2007</year>
          <pub-id pub-id-type="doi">10.1002/ijc.22833</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Zhou</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>N</given-names>
            </name>
            <name>
              <surname>Zhuang</surname>
              <given-names>W</given-names>
            </name>
            <collab>
              <named-content content-type="name">Liu GJ</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Wu TX</named-content>
            </collab>
            <name>
              <surname>Yao</surname>
              <given-names>X</given-names>
            </name>
            <name>
              <surname>Du</surname>
              <given-names>L</given-names>
            </name>
            <collab>
              <named-content content-type="name">Wei ML</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Wu XT</named-content>
            </collab>
          </person-group>
          <source>International Journal of Cancer</source>
          <article-title>P53 codon 72 polymorphism and gastric cancer: a meta-analysis of the literature</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-7729d0fa410f65f5e5a9b073a3e3da0e">
        <element-citation publication-type="journal">
          <issue>2</issue>
          <month>04</month>
          <page-range>509-517</page-range>
          <volume>120</volume>
          <year>2010</year>
          <pub-id pub-id-type="doi">10.1007/s10549-009-0480-4</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Zhang</surname>
              <given-names>Z</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Wu</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Tong</surname>
              <given-names>N</given-names>
            </name>
            <name>
              <surname>Tian</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>Z</given-names>
            </name>
          </person-group>
          <source>Breast Cancer Research and Treatment</source>
          <article-title>P53 codon 72 polymorphism contributes to breast cancer risk: a meta-analysis based on 39 case-control studies</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-f9e35ebca868cc71e46d088693dfe36f">
        <element-citation publication-type="journal">
          <day>11</day>
          <issue>10</issue>
          <month>03</month>
          <page-range>1954-1956</page-range>
          <volume>23</volume>
          <year>2004</year>
          <pub-id pub-id-type="doi">10.1038/sj.onc.1207305</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Gemignani</surname>
              <given-names>F</given-names>
            </name>
            <name>
              <surname>Moreno</surname>
              <given-names>V</given-names>
            </name>
            <name>
              <surname>Landi</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Moullan</surname>
              <given-names>N</given-names>
            </name>
            <name>
              <surname>Chabrier</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Gutiérrez-Enríquez</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Hall</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Guino</surname>
              <given-names>E</given-names>
            </name>
            <collab>
              <named-content content-type="name">Peinado MA</named-content>
            </collab>
            <name>
              <surname>Capella</surname>
              <given-names>G</given-names>
            </name>
            <name>
              <surname>Canzian</surname>
              <given-names>F</given-names>
            </name>
          </person-group>
          <source>Oncogene</source>
          <article-title>A TP53 polymorphism is associated with increased risk of colorectal cancer and with reduced levels of TP53 mRNA</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-e590bdb0ab969b802faad963de8ee249">
        <element-citation publication-type="journal">
          <day>29</day>
          <month>01</month>
          <page-range>32</page-range>
          <volume>8</volume>
          <year>2008</year>
          <pub-id pub-id-type="doi">10.1186/1471-2407-8-32</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Costa</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Pinto</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Pereira</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Rodrigues</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Cameselle-Teijeiro</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Medeiros</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Schmitt</surname>
              <given-names>F</given-names>
            </name>
          </person-group>
          <source>BMC cancer</source>
          <article-title>Importance of TP53 codon 72 and intron 3 duplication 16bp polymorphisms in prediction of susceptibility on breast cancer</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-3741ce9e5f1ecac88aa5e3f9dce37e3e">
        <element-citation publication-type="journal">
          <issue>1</issue>
          <month>11</month>
          <page-range>159-164</page-range>
          <volume>112</volume>
          <year>2008</year>
          <pub-id pub-id-type="doi">10.1007/s10549-007-9838-7</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Kleibl</surname>
              <given-names>Z</given-names>
            </name>
            <name>
              <surname>Havranek</surname>
              <given-names>O</given-names>
            </name>
            <name>
              <surname>Novotny</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Kleiblova</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Soucek</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Pohlreich</surname>
              <given-names>P</given-names>
            </name>
          </person-group>
          <source>Breast Cancer Research and Treatment</source>
          <article-title>Analysis of CHEK2 FHA domain in Czech patients with sporadic breast cancer revealed distinct rare genetic alterations</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-1cab55bac833334addb29dea0ef0a3b3">
        <element-citation publication-type="journal">
          <issue>12</issue>
          <month>12</month>
          <page-range>877-886</page-range>
          <volume>2</volume>
          <year>2001</year>
          <pub-id pub-id-type="doi">10.1038/35103059</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Bartek</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Falck</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Lukas</surname>
              <given-names>J</given-names>
            </name>
          </person-group>
          <source>Nature Reviews. Molecular Cell Biology</source>
          <article-title>CHK2 kinase--a busy messenger</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-928cd86f9d2e1e079d63965d70009200">
        <element-citation publication-type="journal">
          <issue>5</issue>
          <month>05</month>
          <page-range>421-429</page-range>
          <volume>3</volume>
          <year>2003</year>
          <pub-id pub-id-type="doi">10.1016/s1535-6108(03)00110-7</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Bartek</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Lukas</surname>
              <given-names>J</given-names>
            </name>
          </person-group>
          <source>Cancer Cell</source>
          <article-title>Chk1 and Chk2 kinases in checkpoint control and cancer</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-827434342a47a2be021324b7916d887f">
        <element-citation publication-type="journal">
          <issue>2</issue>
          <month>06</month>
          <page-range>100-109</page-range>
          <volume>24</volume>
          <year>2015</year>
          <pub-id pub-id-type="doi">10.1016/j.suronc.2015.04.003</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Aloraifi</surname>
              <given-names>F</given-names>
            </name>
            <collab>
              <named-content content-type="name">Boland MR</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Green AJ</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Geraghty JG</named-content>
            </collab>
          </person-group>
          <source>Surgical Oncology</source>
          <article-title>Gene analysis techniques and susceptibility gene discovery in non-BRCA1/BRCA2 familial breast cancer</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-58f21c702dc487a5ae8d7512c451936b">
        <element-citation publication-type="journal">
          <issue>6</issue>
          <month>12</month>
          <page-range>1131-1135</page-range>
          <volume>75</volume>
          <year>2004</year>
          <pub-id pub-id-type="doi">10.1086/426403</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Cybulski</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Górski</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Huzarski</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Masojć</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Mierzejewski</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Debniak</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Teodorczyk</surname>
              <given-names>U.</given-names>
            </name>
            <name>
              <surname>Byrski</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Gronwald</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Matyjasik</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Zlowocka</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Lenner</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Grabowska</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Nej</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Castaneda</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Medrek</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Szymańska</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Szymańska</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Kurzawski</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Suchy</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Oszurek</surname>
              <given-names>O.</given-names>
            </name>
            <name>
              <surname>Witek</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Narod</surname>
              <given-names>S. A.</given-names>
            </name>
            <name>
              <surname>Lubiński</surname>
              <given-names>J.</given-names>
            </name>
          </person-group>
          <source>American Journal of Human Genetics</source>
          <article-title>CHEK2 is a multiorgan cancer susceptibility gene</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-e6a6339ecd79db8e987519a765658e48">
        <element-citation publication-type="journal">
          <day>01</day>
          <issue>8</issue>
          <month>08</month>
          <page-range>2199-2208</page-range>
          <volume>21</volume>
          <year>2020</year>
          <pub-id pub-id-type="doi">10.31557/APJCP.2020.21.8.2199</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Tiofack</surname>
              <given-names>Arnol T. Z.</given-names>
            </name>
            <name>
              <surname>Simo</surname>
              <given-names>Gustave</given-names>
            </name>
            <name>
              <surname>Ofon</surname>
              <given-names>Elvis</given-names>
            </name>
            <name>
              <surname>Dina-Bell</surname>
              <given-names>Esther</given-names>
            </name>
            <name>
              <surname>Kamla</surname>
              <given-names>Chancelin M.</given-names>
            </name>
            <name>
              <surname>Ananga</surname>
              <given-names>Sidonie N.</given-names>
            </name>
            <name>
              <surname>Roger</surname>
              <given-names>Tchamfong</given-names>
            </name>
            <name>
              <surname>Nana</surname>
              <given-names>Theophile N.</given-names>
            </name>
            <name>
              <surname>Ngeufack</surname>
              <given-names>Charlotte T.</given-names>
            </name>
            <name>
              <surname>Fewou</surname>
              <given-names>Adamou</given-names>
            </name>
            <name>
              <surname>Takongmo</surname>
              <given-names>Samuel</given-names>
            </name>
            <name>
              <surname>Lueong</surname>
              <given-names>Smiths</given-names>
            </name>
          </person-group>
          <source>Asian Pacific journal of cancer prevention: APJCP</source>
          <article-title>The TP63 Gene Polymorphism rs17506395 is Associated with Early Breast Cancer in Cameroon</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-43aca763bfdb44c3406a567add5031f2">
        <element-citation publication-type="journal">
          <source>Available from: http://www.insd.bf/contenu/pub_periodiques/annuaires_stat/Annuaires_stat_nationaux_BF/Annuaire_stat_2014.pdf</source>
          <article-title>Institut national de la statistique et de la démographie (INSD). Annuaire statistique [Internet]. Burkina Faso: 2014</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-12f237c5792a9f37e49c2e2de8bec2d2">
        <element-citation publication-type="journal">
          <day>11</day>
          <issue>3</issue>
          <month>02</month>
          <page-range>1215</page-range>
          <volume>16</volume>
          <year>1988</year>
          <person-group person-group-type="author">
            <name>
              <surname>Miller</surname>
              <given-names>SA</given-names>
            </name>
            <name>
              <surname>Dykes</surname>
              <given-names>DD</given-names>
            </name>
            <name>
              <surname>Polesky</surname>
              <given-names>HF</given-names>
            </name>
          </person-group>
          <source>Nucleic Acids Research</source>
          <article-title>A simple salting out procedure for extracting DNA from human nucleated cells.</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-57c5908c14d932d1c1ff42c709cbd30d">
        <element-citation publication-type="journal">
          <issue>1</issue>
          <month>02</month>
          <page-range>38-42</page-range>
          <volume>173</volume>
          <year>2007</year>
          <pub-id pub-id-type="doi">10.1016/j.cancergencyto.2006.09.010</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Khadang</surname>
              <given-names>B</given-names>
            </name>
            <collab>
              <named-content content-type="name">Fattahi MJ</named-content>
            </collab>
            <name>
              <surname>Talei</surname>
              <given-names>A</given-names>
            </name>
            <collab>
              <named-content content-type="name">Dehaghani AS</named-content>
            </collab>
            <name>
              <surname>Ghaderi</surname>
              <given-names>A</given-names>
            </name>
          </person-group>
          <source>Cancer Genetics and Cytogenetics</source>
          <article-title>Polymorphism of TP53 codon 72 showed no association with breast cancer in Iranian women</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-e3101d31bb24457dfa65b202a18a47d0">
        <element-citation publication-type="journal">
          <issue>4</issue>
          <page-range>837-845</page-range>
          <volume>26</volume>
          <year>2017</year>
          <pub-id pub-id-type="doi">10.1007/s00580-017-2455-x</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Jalilvand</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Oloomi</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Najafipour</surname>
              <given-names>R</given-names>
            </name>
            <collab>
              <named-content content-type="name">Alizadeh SA</named-content>
            </collab>
            <name>
              <surname>Saki</surname>
              <given-names>N</given-names>
            </name>
            <collab>
              <named-content content-type="name">Rad FS</named-content>
            </collab>
            <name>
              <surname>Shekari</surname>
              <given-names>M</given-names>
            </name>
          </person-group>
          <source>Comparative Clinical Pathology</source>
          <article-title>An association study between CHEK2 gene mutations and susceptibility to breast cancer</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-4dd85028c96a07fd0988d3f89752c3f0">
        <element-citation publication-type="journal">
          <issue>3</issue>
          <page-range>113-120</page-range>
          <volume>13</volume>
          <year>2013</year>
          <person-group person-group-type="author">
            <collab>
              <named-content content-type="name">Oladimeji KE</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Ajayi IO</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Okareh OT</named-content>
            </collab>
          </person-group>
          <source>Nigerian Health Journal</source>
          <article-title>Risk Factors Associated with Breast Cancer among Women in Warri and lbadan, Nigeria</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-c2b57cf0ec2b3a44ef2b76abb7ec7346">
        <element-citation publication-type="journal">
          <day>12</day>
          <issue>10</issue>
          <month>10</month>
          <page-range>e039464</page-range>
          <volume>10</volume>
          <year>2020</year>
          <pub-id pub-id-type="doi">10.1136/bmjopen-2020-039464</pub-id>
          <person-group person-group-type="author">
            <collab>
              <named-content content-type="name">Ba DM</named-content>
            </collab>
            <name>
              <surname>Ssentongo</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Agbese</surname>
              <given-names>E</given-names>
            </name>
            <name>
              <surname>Yang</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Cisse</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Diakite</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Traore CB</surname>
              <given-names>Cheick Bougadari</given-names>
            </name>
            <collab>
              <named-content content-type="name">et al</named-content>
            </collab>
          </person-group>
          <source>BMJ open</source>
          <article-title>Prevalence and determinants of breast cancer screening in four sub-Saharan African countries: a population-based study</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-19288400c4f36bcf6ad2440703b87f84">
        <element-citation publication-type="journal">
          <day>15</day>
          <issue>8</issue>
          <month>10</month>
          <page-range>734-742</page-range>
          <volume>162</volume>
          <year>2005</year>
          <pub-id pub-id-type="doi">10.1093/aje/kwi278</pub-id>
          <person-group person-group-type="author">
            <collab>
              <named-content content-type="name">McCullough ML</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Feigelson HS</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Diver WR</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Patel AV</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Thun MJ</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Calle EE</named-content>
            </collab>
          </person-group>
          <source>American Journal of Epidemiology</source>
          <article-title>Risk factors for fatal breast cancer in African-American women and White women in a large US prospective cohort</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-60c8c081e4fb31a38f45cfcd3f66ed7a">
        <element-citation publication-type="journal">
          <issue>1</issue>
          <page-range>1101-1110</page-range>
          <volume>16</volume>
          <year>2021</year>
          <pub-id pub-id-type="doi">10.1515/biol-2021-0113</pub-id>
          <person-group person-group-type="author">
            <collab>
              <named-content content-type="name">Zouré AA</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Amegnona LJ</named-content>
            </collab>
            <name>
              <surname>Zongo</surname>
              <given-names>N</given-names>
            </name>
            <collab>
              <named-content content-type="name">Kiendrebeogo IT</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Sorgho PA</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Zongo FI</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Yonli AT</named-content>
            </collab>
            <collab>
              <named-content content-type="name">et al</named-content>
            </collab>
          </person-group>
          <source>Open Life Sciences</source>
          <article-title>Carriage of HLA-DRB1*11 and 1*12 alleles and risk factors in patients with breast cancer in Burkina Faso</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-b698ef1928cc49521ef86520ea7aa7d7">
        <element-citation publication-type="journal">
          <day>15</day>
          <issue>8</issue>
          <month>04</month>
          <page-range>1540-1550</page-range>
          <volume>103</volume>
          <year>2005</year>
          <pub-id pub-id-type="doi">10.1002/cncr.20978</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Fregene</surname>
              <given-names>A</given-names>
            </name>
            <collab>
              <named-content content-type="name">Newman LA</named-content>
            </collab>
          </person-group>
          <source>Cancer</source>
          <article-title>Breast cancer in sub-Saharan Africa: how does it relate to breast cancer in African-American women?</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-51b335fa3226fc5d78f356972ba301d2">
        <element-citation publication-type="journal">
          <issue>3</issue>
          <month>05</month>
          <page-range>209-249</page-range>
          <volume>71</volume>
          <year>2021</year>
          <pub-id pub-id-type="doi">10.3322/caac.21660</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Sung</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Ferlay</surname>
              <given-names>J</given-names>
            </name>
            <collab>
              <named-content content-type="name">Siegel RL</named-content>
            </collab>
            <name>
              <surname>Laversanne</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Soerjomataram</surname>
              <given-names>I</given-names>
            </name>
            <name>
              <surname>Jemal</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Bray</surname>
              <given-names>F</given-names>
            </name>
          </person-group>
          <source>CA: a cancer journal for clinicians</source>
          <article-title>Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-45b6e211b71d5a05d704a0d4480cc159">
        <element-citation publication-type="journal">
          <issue>2</issue>
          <month>02</month>
          <page-range>175-180</page-range>
          <volume>21</volume>
          <year>2005</year>
          <pub-id pub-id-type="doi">10.1051/medsci/2005212175</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Nkondjock</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Ghadirian</surname>
              <given-names>P</given-names>
            </name>
          </person-group>
          <source>Medecine Sciences: M/S</source>
          <article-title>[Risk factors and risk reduction of breast cancer]</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-4f87a2036a144282743776c96f469d30">
        <element-citation publication-type="journal">
          <issue>8</issue>
          <month>08</month>
          <page-range>771-775</page-range>
          <volume>79</volume>
          <year>1992</year>
          <pub-id pub-id-type="doi">10.1002/bjs.1800790819</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Ihekwaba</surname>
              <given-names>FN</given-names>
            </name>
          </person-group>
          <source>The British Journal of Surgery</source>
          <article-title>Breast cancer in Nigerian women</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-c708edb70efe859a7f3dcd151e36575c">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <collab>
              <named-content content-type="name">Almutlaq BA</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Almuazzi RF</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Almuhayfir AA</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Alfouzan AM</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Alshammari BT</named-content>
            </collab>
            <collab>
              <named-content content-type="name">AlAnzi HS</named-content>
            </collab>
            <collab>
              <named-content content-type="name">et al</named-content>
            </collab>
          </person-group>
          <source>Journal of Cancer Policy [Internet] 2017 [cité 2020 déc 29];12:83‑9. Available from: https://linkinghub.elsevier.com/retrieve/pii/S2213538316300558</source>
          <article-title>Breast cancer in Saudi Arabia and its possible risk factors.</article-title>
        </element-citation>
      </ref>
	  <ref id="journal-article-ref-5375d52e3a0d23f5879cb405742e93bc">
        <element-citation publication-type="journal">
          <issue>11</issue>
          <page-range>1387-1397</page-range>
          <volume>13</volume>
          <year>2017</year>
          <pub-id pub-id-type="doi">10.7150/ijbs.21635</pub-id>
          <person-group person-group-type="author">
            <collab>
              <named-content content-type="name">Sun YS</named-content>
            </collab>
            <name>
              <surname>Zhao</surname>
              <given-names>Z</given-names>
            </name>
            <collab>
              <named-content content-type="name">Yang ZN</named-content>
            </collab>
            <name>
              <surname>Xu</surname>
              <given-names>F</given-names>
            </name>
            <collab>
              <named-content content-type="name">Lu HJ</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Zhu ZY</named-content>
            </collab>
            <name>
              <surname>Shi</surname>
              <given-names>W</given-names>
            </name>
            <name>
              <surname>Jiang</surname>
              <given-names>J</given-names>
            </name>
            <collab>
              <named-content content-type="name">Yao PP</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Zhu HP</named-content>
            </collab>
          </person-group>
          <source>International Journal of Biological Sciences</source>
          <article-title>Risk Factors and Preventions of Breast Cancer</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-c15a7ac5c015258a6e966a4948ecf0d8">
        <element-citation publication-type="journal">
          <day>01</day>
          <issue>9</issue>
          <month>11</month>
          <page-range>2179-2185</page-range>
          <volume>119</volume>
          <year>2006</year>
          <pub-id pub-id-type="doi">10.1002/ijc.22102</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Okobia</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Bunker</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Zmuda</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Kammerer</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Vogel</surname>
              <given-names>V</given-names>
            </name>
            <name>
              <surname>Uche</surname>
              <given-names>E</given-names>
            </name>
            <name>
              <surname>Anyanwu</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Ezeome</surname>
              <given-names>E</given-names>
            </name>
            <name>
              <surname>Ferrell</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Kuller</surname>
              <given-names>L</given-names>
            </name>
          </person-group>
          <source>International Journal of Cancer</source>
          <article-title>Case-control study of risk factors for breast cancer in Nigerian women</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-1f8f99cf26e966bbe19c452df9f02d59">
        <element-citation publication-type="journal">
          <month>12</month>
          <page-range>764-770</page-range>
          <volume>1010</volume>
          <year>2003</year>
          <pub-id pub-id-type="doi">10.1196/annals.1299.137</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Mabrouk</surname>
              <given-names>I</given-names>
            </name>
            <name>
              <surname>Baccouche</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>El-Abed</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Mokdad-Gargouri</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Mosbah</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Saïd</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Daoud</surname>
              <given-names>J</given-names>
            </name>
            <collab>
              <named-content content-type="name">et al</named-content>
            </collab>
          </person-group>
          <source>Annals of the New York Academy of Sciences</source>
          <article-title>No evidence of correlation between p53 codon 72 polymorphism and risk of bladder or breast carcinoma in Tunisian patients</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-7b465077f36e1baba3ac2761f81127e4">
        <element-citation publication-type="journal">
          <issue>3</issue>
          <page-range>197-206</page-range>
          <volume>3</volume>
          <year>2002</year>
          <person-group person-group-type="author">
            <name>
              <surname>Hamajima</surname>
              <given-names>N</given-names>
            </name>
            <name>
              <surname>Takezaki</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Tajima</surname>
              <given-names>K</given-names>
            </name>
          </person-group>
          <source>Asian Pacific journal of cancer prevention: APJCP</source>
          <article-title>Allele Frequencies of 25 Polymorphisms Pertaining to Cancer Risk for Japanese, Koreans and Chinese</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-15eabea4a6304fb876edcb406ad0bedb">
        <element-citation publication-type="journal">
          <issue>2</issue>
          <page-range>114-118</page-range>
          <volume>56</volume>
          <year>2009</year>
          <pub-id pub-id-type="doi">10.4149/neo_2009_02_114</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Cao</surname>
              <given-names>Z</given-names>
            </name>
            <collab>
              <named-content content-type="name">Song JH</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Park YK</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Maeng EJ</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Nam SW</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Lee JY</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Park WS</named-content>
            </collab>
          </person-group>
          <source>Neoplasma</source>
          <article-title>The p53 codon 72 polymorphism and susceptibility to colorectal cancer in Korean patients</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-7f739184fedb837a2f00cfa6266feb61">
        <element-citation publication-type="journal">
          <issue>5</issue>
          <month>05</month>
          <page-range>385-390</page-range>
          <volume>37</volume>
          <year>2007</year>
          <pub-id pub-id-type="doi">10.1093/jjco/hym034</pub-id>
          <person-group person-group-type="author">
            <collab>
              <named-content content-type="name">Zhu ZZ</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Wang AZ</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Jia HR</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Jin XX</named-content>
            </collab>
            <collab>
              <named-content content-type="name">He XL</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Hou LF</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Zhu G</named-content>
            </collab>
          </person-group>
          <source>Japanese Journal of Clinical Oncology</source>
          <article-title>Association of the TP53 codon 72 polymorphism with colorectal cancer in a Chinese population</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-e36d8da6a942288ad34d5a41d05bca8b">
        <element-citation publication-type="journal">
          <issue>11</issue>
          <page-range>2909-2913</page-range>
          <volume>12</volume>
          <year>2011</year>
          <person-group person-group-type="author">
            <collab>
              <named-content content-type="name">Aizat AAA</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Shahpudin SNM</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Mustapha MA</named-content>
            </collab>
            <name>
              <surname>Zakaria</surname>
              <given-names>Z</given-names>
            </name>
            <collab>
              <named-content content-type="name">Sidek ASM</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Abu Hassan MR</named-content>
            </collab>
            <name>
              <surname>Ankathil</surname>
              <given-names>R</given-names>
            </name>
          </person-group>
          <source>Asian Pacific journal of cancer prevention: APJCP</source>
          <article-title>Association of Arg72Pro of P53 polymorphism with colorectal cancer susceptibility risk in Malaysian population</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-ec9fd6e95c9b0f7bcae9da449a44798d">
        <element-citation publication-type="journal">
          <issue>6</issue>
          <month>06</month>
          <page-range>389-392</page-range>
          <volume>3</volume>
          <year>2000</year>
          <pub-id pub-id-type="doi">10.1006/mcbr.2000.0241</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Papadakis</surname>
              <given-names>EN</given-names>
            </name>
            <name>
              <surname>Dokianakis</surname>
              <given-names>DN</given-names>
            </name>
            <name>
              <surname>Spandidos</surname>
              <given-names>DA</given-names>
            </name>
          </person-group>
          <source>Molecular cell biology research communications: MCBRC</source>
          <article-title>p53 codon 72 polymorphism as a risk factor in the development of breast cancer</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-2ff0f3fe2c33414a69ff19b4edd6585b">
        <element-citation publication-type="journal">
          <issue>3</issue>
          <month>03</month>
          <page-range>357-365</page-range>
          <volume>33</volume>
          <year>2003</year>
          <pub-id pub-id-type="doi">10.1038/ng1093</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Dumont</surname>
              <given-names>P</given-names>
            </name>
            <collab>
              <named-content content-type="name">Leu JL</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Della Pietra AC</named-content>
            </collab>
            <collab>
              <named-content content-type="name">George DL</named-content>
            </collab>
            <name>
              <surname>Murphy</surname>
              <given-names>M</given-names>
            </name>
          </person-group>
          <source>Nature Genetics</source>
          <article-title>The codon 72 polymorphic variants of p53 have markedly different apoptotic potential</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-d56fe20e268d2079b84f8e53ec6f252d">
        <element-citation publication-type="journal">
          <day>10</day>
          <issue>2</issue>
          <month>01</month>
          <page-range>196-199</page-range>
          <volume>108</volume>
          <year>2004</year>
          <pub-id pub-id-type="doi">10.1002/ijc.11548</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Pim</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Banks</surname>
              <given-names>L</given-names>
            </name>
          </person-group>
          <source>International Journal of Cancer</source>
          <article-title>p53 polymorphic variants at codon 72 exert different effects on cell cycle progression</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-a631c8eff8e71f2bc1aa251e178505c5">
        <element-citation publication-type="journal">
          <day>11</day>
          <issue>6</issue>
          <month>06</month>
          <page-range>1295-1301</page-range>
          <volume>204</volume>
          <year>2007</year>
          <pub-id pub-id-type="doi">10.1084/jem.20062476</pub-id>
          <person-group person-group-type="author">
            <collab>
              <named-content content-type="name">Ørsted DD</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Bojesen SE</named-content>
            </collab>
            <name>
              <surname>Tybjaerg-Hansen</surname>
              <given-names>A</given-names>
            </name>
            <collab>
              <named-content content-type="name">Nordestgaard BG</named-content>
            </collab>
          </person-group>
          <source>The Journal of Experimental Medicine</source>
          <article-title>Tumor suppressor p53 Arg72Pro polymorphism and longevity, cancer survival, and risk of cancer in the general population</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-a47b24438009e7ef27e7d662cd4ee02e">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Syeed</surname>
              <given-names>N</given-names>
            </name>
          </person-group>
          <source>World J Oncol [Internet] 2010 [cité 2022 mai 20];Available from: http://www.wjon.org/index.php/wjon/article/view/261</source>
          <article-title>A Case-Control Study of TP53 R72P Polymorphism in the Breast Cancer Patients of Ethnic Kashmiri Population</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-efe5a66ea6d87c8325f057ab9f2b5cb9">
        <element-citation publication-type="journal">
          <day>13</day>
          <issue>2</issue>
          <month>04</month>
          <page-range>651-660</page-range>
          <volume>9</volume>
          <year>2010</year>
          <pub-id pub-id-type="doi">10.4238/vol9-2gmr751</pub-id>
          <person-group person-group-type="author">
            <collab>
              <named-content content-type="name">Sameer AS</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Shah ZA</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Syeed N</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Banday MZ</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Bashir SM</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Bhat BA</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Siddiqi MA</named-content>
            </collab>
          </person-group>
          <source>Genetics and molecular research: GMR</source>
          <article-title>TP53 Pro47Ser and Arg72Pro polymorphisms and colorectal cancer predisposition in an ethnic Kashmiri population</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-4592e4081b3d7985fb024b4acf457ba3">
        <element-citation publication-type="journal">
          <day>20</day>
          <issue>3</issue>
          <month>01</month>
          <page-range>431-433</page-range>
          <volume>103</volume>
          <year>2003</year>
          <pub-id pub-id-type="doi">10.1002/ijc.10834</pub-id>
          <person-group person-group-type="author">
            <collab>
              <named-content content-type="name">Suspitsin EN</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Buslov KG</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Grigoriev MY</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Ishutkina JG</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Ulibina JM</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Gorodinskaya VM</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Pozharisski KM</named-content>
            </collab>
            <collab>
              <named-content content-type="name">et al</named-content>
            </collab>
          </person-group>
          <source>International Journal of Cancer</source>
          <article-title>Evidence against involvement of p53 polymorphism in breast cancer predisposition</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-f1505161689ab8a6bdc45bda9f29dc52">
        <element-citation publication-type="journal">
          <issue>3</issue>
          <month>04</month>
          <page-range>269-272</page-range>
          <volume>12</volume>
          <year>2002</year>
          <pub-id pub-id-type="doi">10.1097/00008571-200204000-00012</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Wang-Gohrke</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Becher</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Kreienberg</surname>
              <given-names>R</given-names>
            </name>
            <collab>
              <named-content content-type="name">Runnebaum IB</named-content>
            </collab>
            <name>
              <surname>Chang-Claude</surname>
              <given-names>J</given-names>
            </name>
          </person-group>
          <source>Pharmacogenetics</source>
          <article-title>Intron 3 16 bp duplication polymorphism of p53 is associated with an increased risk for breast cancer by the age of 50 years</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-f49d6fa6f15d666f83386a7165dd6ed5">
        <element-citation publication-type="journal">
          <issue>3</issue>
          <page-range>298-302</page-range>
          <volume>48</volume>
          <year>2011</year>
          <pub-id pub-id-type="doi">10.4103/0019-509X.84925</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Faghani</surname>
              <given-names>M</given-names>
            </name>
            <collab>
              <named-content content-type="name">Ghasemi FM</named-content>
            </collab>
            <name>
              <surname>Nikhbakht</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Salehi</surname>
              <given-names>M</given-names>
            </name>
          </person-group>
          <source>Indian Journal of Cancer</source>
          <article-title>TP53 PIN3 polymorphism associated with breast cancer risk in Iranian women</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-56df8b7b1fe66c3c87a61232703c05f5">
        <element-citation publication-type="journal">
          <issue>6</issue>
          <month>06</month>
          <page-range>1175-1182</page-range>
          <volume>74</volume>
          <year>2004</year>
          <pub-id pub-id-type="doi">10.1086/421251</pub-id>
          <source>American Journal of Human Genetics</source>
          <article-title>CHEK2*1100delC and susceptibility to breast cancer: a collaborative analysis involving 10,860 breast cancer cases and 9,065 controls from 10 studies</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-363f593822e3d63d25e2290dfa60cbfa">
        <element-citation publication-type="journal">
          <issue>6</issue>
          <month>06</month>
          <page-range>e168</page-range>
          <volume>3</volume>
          <year>2006</year>
          <pub-id pub-id-type="doi">10.1371/journal.pmed.0030168</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Einarsdóttir</surname>
              <given-names>K</given-names>
            </name>
            <name>
              <surname>Humphreys</surname>
              <given-names>K</given-names>
            </name>
            <name>
              <surname>Bonnard</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Palmgren</surname>
              <given-names>J</given-names>
            </name>
            <collab>
              <named-content content-type="name">Iles MM</named-content>
            </collab>
            <name>
              <surname>Sjölander</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>Y</given-names>
            </name>
            <collab>
              <named-content content-type="name">et al</named-content>
            </collab>
          </person-group>
          <source>PLoS medicine</source>
          <article-title>Linkage disequilibrium mapping of CHEK2: common variation and breast cancer risk</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-b3f1c93d3689b250fcf6055e020e71b2">
        <element-citation publication-type="journal">
          <day>03</day>
          <issue>1</issue>
          <month>01</month>
          <page-range>6-9</page-range>
          <volume>2</volume>
          <year>2014</year>
          <pub-id pub-id-type="doi">10.12691/jcrt-2-1-2</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>ElAmrani</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Moumad</surname>
              <given-names>K</given-names>
            </name>
            <name>
              <surname>Attaleb</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Benhassou</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Försti</surname>
              <given-names>A</given-names>
            </name>
            <collab>
              <named-content content-type="name">Ennaji MM</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Mzibri ME</named-content>
            </collab>
            <name>
              <surname>Khyatti</surname>
              <given-names>M</given-names>
            </name>
          </person-group>
          <source>Journal of Cancer Research and Treatment</source>
          <article-title>Absence of CHEK2 1100delC, R145W and I157T Mutations in Breast Cancer in a Moroccan Population</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-da474e2d2028f091f86b59b2e5c6c447">
        <element-citation publication-type="journal">
          <issue>12</issue>
          <month>12</month>
          <page-range>800-811</page-range>
          <volume>53</volume>
          <year>2016</year>
          <pub-id pub-id-type="doi">10.1136/jmedgenet-2016-103839</pub-id>
          <person-group person-group-type="author">
            <collab>
              <named-content content-type="name">Southey MC</named-content>
            </collab>
            <collab>
              <named-content content-type="name">Goldgar DE</named-content>
            </collab>
            <name>
              <surname>Winqvist</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Pylkäs</surname>
              <given-names>K</given-names>
            </name>
            <name>
              <surname>Couch</surname>
              <given-names>F</given-names>
            </name>
            <name>
              <surname>Tischkowitz</surname>
              <given-names>M</given-names>
            </name>
            <collab>
              <named-content content-type="name">Foulkes WD</named-content>
            </collab>
            <collab>
              <named-content content-type="name">et al</named-content>
            </collab>
          </person-group>
          <source>Journal of Medical Genetics</source>
          <article-title>PALB2, CHEK2 and ATM rare variants and cancer risk: data from COGS</article-title>
        </element-citation>
      </ref>
      <ref id="journal-article-ref-86b048dab1c0264f85ba8bde8f72b8fc">
        <element-citation publication-type="journal">
          <day>25</day>
          <issue>43</issue>
          <month>09</month>
          <page-range>5912-5919</page-range>
          <volume>25</volume>
          <year>2006</year>
          <pub-id pub-id-type="doi">10.1038/sj.onc.1209877</pub-id>
          <person-group person-group-type="author">
            <name>
              <surname>Nevanlinna</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Bartek</surname>
              <given-names>J</given-names>
            </name>
          </person-group>
          <source>Oncogene</source>
          <article-title>The CHEK2 gene and inherited breast cancer susceptibility</article-title>
        </element-citation>
      </ref>
    </ref-list>
  </back>
</article>